2018 Annual Report
The path to
owning special
We live in an era of incredible convenience,
matched with equally incredible price and selection.
Any commodity item can be purchased with
one click, packed by a robot, and land at your
door virtually the next day. But when the world
develops a default, it also craves the antidote.
We believe Etsy is the antidote to commoditized
commerce—I often call us the home for special.
As massive e-tailers compete to dominate the
world of the everyday, many of us shop with them
for the commodities of life. They are increasingly
commoditizing everything, reducing online
shopping to price and speed of delivery. But it is
very hard for them to be the place we want to go
when we want something to be, or to feel, special.
Test yourself. Think back over the last year, and to
all of the moments that mattered to you. You may
think of the wedding of a loved one, a celebration
or birthday, or furnishing a new home. With over
60 million items, chances are Etsy sellers have the
perfect thing for those perfect moments in your
life, moments when you want to show you care
or express your own individual style. Etsy also
makes the smaller moments in life special. A family
connects in a kitchen over flour, butter, and salt—
and a rolling pin from Etsy, embossed with hearts,
that literally presses images of love into every cookie
and crust. This is how Etsy elevates the everyday.
With so many moments in life deserving
a human touch, we believe the market for
“special” is enormous. In our top six geographies
alone, online shopping spend in relevant categories
is nearly $250 billion annually. And even after
our strong growth in 2018, we are still very small
compared to this market opportunity, with 2018
Gross Merchandise Sales (GMS) of $3.9 billion
representing less than 2% market share.
And we’re just getting started. Two-sided
marketplaces are lightning in a bottle—only a
few have been able to scale. They are incredibly
hard to build, but once scaled, like Etsy, they are
incredibly resilient, and get better as they get
bigger. Etsy has two-sided vibrancy: buyers come
because of our sellers, and sellers come because
of our buyers. And in 2018 we grew our active
seller count by over 9% to 2.1 million and active
buyer count by over 18% to 39.4 million.
2018 Integrated Report
1
Over the past two years, we’ve raised the bar not
only around delivering great business results, but
also around having a positive impact on both people
and the planet. Our business and social impact
are fully aligned. Economic empowerment is our
day job: by bringing more buyers to Etsy, we have
put more money in our sellers’ pockets and helped
them achieve their personal and financial goals.
We are proud of our progress on gender diversity:
we have achieved gender parity at the leadership
level, including our executive team and Board of
Directors. We have also made great progress in
mitigating our ecological impact, having recently
become the first global ecommerce company
to offset 100% of carbon emissions generated
by shipping. And we did it at a cost to us of less
than a penny a package. By holding ourselves
accountable to measurable impact goals, great
intentions can translate to great outcomes.
We have demonstrated our ability to drive
operational excellence and financial performance
while raising the bar for corporate citizenship.
I am extremely proud of our team’s work positioning
Etsy for sustainable growth by building a world-class
buying and selling experience. We’re excited about
the foundations that we’ve laid because we believe
they pave the way for the next chapter of Etsy’s story.
Onward,
Josh Silverman
Chief Executive Officer, Etsy
While we are still in the early innings of realizing
the opportunity for “owning special,” I am very
proud of the progress our team made in 2018.
We brought renewed focus to the business, made
significant investments in product development,
marketing, and technology and drove operational
excellence and strong financial performance.
GMS rose 21%, revenue climbed 37%, and we
significantly improved our margins. It’s important
to note we’ve done this while becoming more
efficient. Etsy teams are clear on their mission and
on what success looks like and we’ve nearly doubled
revenue per employee over the past two years.
We still have exciting work ahead to deliver the
delightful product experience that will bring to
life the true promise of Etsy. Etsy has four areas of
sustainable competitive advantage, our “Right to
Win,” where we are good today or plan to be great
in the future. We are confident that the combination
of these factors gives us the right to be a very big
business, with many years of growth ahead of us.
• We start from a foundation of over
60 million listings. We believe no one else
comes close in breadth and depth of unique
offerings, which include handmade and
vintage products from all over the world.
• To make sense of this vast sea of listings, we
must solve the tyranny of choice. A track of
work on best-in-class search and discovery
will surface high-quality items that feel
curated to the individual shopper.
• Now that we’ve shown you something that speaks
to you, what happens next is the real magic:
unlocking the power of human connection.
Unlike other shopping destinations, there’s a
person behind every item, waiting to answer
your questions and personalize or customize
that item just for you. This is where Etsy already
stands out and we plan to continue improving
as we lean into making these human connections
an even bigger focal point of our marketplace.
• Finally, the collective of Etsy’s 2.1 million active
sellers needs to feel to the shopper like a cohesive
brand you can trust. We are excited for the work
ahead, building a strong brand promise embedded
with trust signals and best-in-class support.
2
Keep
Commerce
Human
This is our mission. It’s at
the heart of everything we do.
Karina Daniel Parris
www.etsy.com/shop/LovelyEarthlings
Brooklyn, New York
2018 Integrated Report
3
In 2018, we introduced a new set of guiding principles.
These principles serve as our North Star and reflect
how we strive to act. They enable individuals, teams,
and our entire company to have a greater impact
as we work together to achieve our mission.
We commit to our craft. Our work has the power
to change lives. That’s why we strive to learn
continuously and excel at what we do.
We minimize waste. Time, resources, and energy
are precious, so we focus only on what will have
the greatest impact.
We embrace differences. Diverse teams are
stronger, and inclusive cultures are more resilient.
When we seek out different perspectives, we make
better decisions and build better products.
We dig deeper. The best solutions to meaningful
challenges are rarely easy or obvious. We stay
curious, balance our intuition with insights,
and decide with confidence.
We lead with optimism. We believe in our mission,
and we believe in each other. We see the world as
it is, set ambitious goals, and inspire one another
with generosity of spirit. Together, we reimagine
what is possible.
44444444
Nurturing our marketplace
Etsy is the global two-sided
marketplace for unique and creative
goods. We connect millions of buyers
and sellers from nearly every country.
In a world of increasing automation and
commoditization, we believe creativity cannot
be automated and human connection cannot
be commoditized.
There are several characteristics that differentiate
Etsy. Collectively, we call them our “Right to Win.”
By focusing on these areas, we aim to provide
the best possible experience for our customers.
Our Right to Win
Best-in-class search
and discovery
The power of
human connections
A brand
you can trust
X
Our collection of unique items
AAAAtttt EEttttssssyyyyy,,
wewewe we belbelbebe ievievievieve te e te herherherhereee
arearerere mmamamany ny nyy n occoccoccocco asiasiasias onsonsonso
thrthrrhrougougougghouhouhouhhout tt t tt tthe he he yeayeayeye r ffr f for or o
us us usus to toto coconcoonnecnecnecnect bt bt bbuyeuyeuyeuyers rsrsrs
witwitwitth sh sh sh sellellellellerserrsrs. H. H. H. Hereereereee arararareeee
jusjusjust at aa a fefefefeew ww ew xamxamamxampleplepleples.s...
ValValValValententntentineineinei
’s ’ss DayDayDayD y
EasEasEasstertererer
MotMotMotherheherherr’s s s s DayDayDayDay
January
February
March
April
May
June
WedWedWedWeddindididingggg
NewNewww hohohh meme
2012012018 I8 I8 Intentententegragratedted ReReReReppporportt
555
Connecting and
serving real people
a aaa perperperersonsonsonsonalialalializedzedzedzed shhshshshoppoppoppoppinginginging exexexexperperperrp ienieneniene ceccece
BuyBuyBuyBuyBuyersersersersrs cocoocome me mememe tototooo ourourourour mamamamamarkerkerkerketpltplpltpllacaceaceee tototototo bebebebebe inninininspispispispip redredredreded
andandandndand dedededed ligligliglightehtehtehted bd bd d bd by tyy tyy he hehehe e momormormoro e te te te te thanhanhanhanhan 60606060 mimmm llililil ononoo iteiteiteitet msmssmsms
lovlovlovloviningngngngly ly lylyy cracrararaftefteteftefted od od od od r cr cr ccr urauraraurau tedteddtedd bybybybyb rererereal al al al peopeopeopeopeoplepleee. I. I. IIn fn fn fn fn actactactact, ,
78%78%78%78%% ofofofofof bubbububuyeryeryerery ss ss ss ss sayayayay thethethethey cy cy ccy omeomeomeomee tototoo EtEtEtE sysy sysy forforforforfo ititemsemsmsmems ththhtheyeyeye
cancancancancan’t ’t ’tt fifinfininnd ad ad ad nywnywywnywnywherherherherh e ee ee ee ee elselsesesee.**.*.* OnOOnnOn ourourourour plplplplp atfatfatata ormormormmorm, E, E, E, E, tsytsysytsytsy
buybuybuybuyuyersersersers eneenenjoyjoyjoyoj
andandandandd cacacacaan bn bbn bn builuiluilui d rd rd rd rd relaelaelaatiotiotionshnshnshnshipsipipsipsps wiwiwithththth EtsEtssEtsEtsy sy sy sy sy sellellellellellersersersers
thrhrhrhrt ougougougouggh dh dh d direireeect ct ct ct intintintinteraerararactictictict onsonsonsons anananndd cd cd cd convonvonvonversersersrsatiatiatiationsononsonsons...
We WWe We belbbelbelievievevieve e te te te herherherherh e ae ae aare re re re manmanmanmamany my my mmmomeomeomeomentsntsntsntsnts ininin liliiifefefefefe thathth t t ttt
calcalcalcaca l fl fl fl foror or o somsoomomo etethetethe inginginggng aaaa litititttletletletletle leleleeless ss ssss ordordrdordordinainainainin ry,ry,y,y, anananna d ad ad ad ad lololoot tt
momorrre se see specpecpecp ial
ialal. W. W. W. W. We bbbe belielielieveeveeveeve ththththatat at at thethethethet
ial
ial
“sp“sp“sp“specieciecec al”al”al”al” ococococcascascascassionionionioions ts ts tthrohroughughughughughoutoutoutoutout ththththe ye ye ye yearearearear whwhwhwhwhereereereere
EtsEtsEtsEtsy cy cy cy cy cananana andandandandd shshhshhouloulouloulu d bd bd bd bd e te te e opopp of fof of f minminminminmind fd fd fd fd or ororor buybuybuybuyerserssers.
rere rere arearearear mamamamanyny ny n
EtsEtsy sy sy sy sellellelelll ersersersrsers arararara e e ae at tt ttthehehe he he veververervery hy hy hy hearearareart ot ot ot ot of of of of of our uruurur busbusbususbusineineineinen ss.ss.ss.s
PowPowPowPowPowerereereeree d bbbd by iy iy iy imagmagmagagaginainainanain tiotiotiotiotion, n,n, n,, 2.12.12.1. mimimmimillillillillionon onon selselellelllerlerlerers**s**s**s**s* ususussu e e eee
thethethetheh EtEtE sy sy plapplap tfotfofotfoorm
rm to tototto purpuruu suesueueeue thththhtheireireireireir crcrcrcrc aftaftaftafafts as as a as ndndndndnd grogrogrogrogrowwww
rmrmrm
thethethetheir iiir busbusbusbusbu ineineineein ssessessesess. RanRanRR ginginginging fg fgg romromomrom hohohohohobbybbybbybbybbyistististisists ts tss to oo o
proprop op fesfesfefe siosiosiosionalnalalnana arararartististististisansansansans, t, t, tttheyheyhehe ararararre te te te tthe he he hehe crecrecrecrc atiatiatiatiative veveve forforforforce ce cecece thathaththathatttt
capcapcapcaptivivivivateateateea s bs bs bs bs buyeuyeuyeuyeuyerssrsrsrs andndandandnd kekekekeepsepsepseps ususussu mommomomovinvinvinving fg fg g fg forworworwoo ardarda .
sfosfosfosfoformrmrmrmm
WWeWe WeWe areareareare cocoococommmmimmimimmittettettetted td td tdd to ho ho ho ho helpelpelpelpelpingingingingng EtEtEtEtEtsy sy sy ssy seselsees lerlerlerlerl s ts ts ts ttranranrananr
thetheththeir crecreccc atiatiatiatit ve veveve paspaspaspaspassiosiosiosiosions nsns ns ns intntintintinto o po po po ersersersersersonononaonaon l fl f f fulfulfulfulfulfilillllillllmenmenmenmenme tt, t, t,
ecoecoecoecoonomnomnomnomomicicic oppoppoppoppopportortortortuniuniuniuniun ty,ty,tty,y, anananand ed ed ed ed empmpompommpowerweerere menmenmenmenme t. t.. In nnnn
addaddaddadditititition onon on totooo bribrririringingingngiinngngng ooourour sesesesellellellellell rsrss milmilmilmi liolioiolions ns ofof ofof f buyuybuybuybuyeersersersers, ,
wewewewe offeoffeoffeoffeoff r tr tr tr tr hemhhemhem aa ranrange ge ge ge ofofofof tootooooooo lslslssl andandandandan seseseseervirvirvv cescesss tototooo hehehehelp
lp
lp
lp
thethehthem gm gm gm geneeneeneneeratratratra e me me mee moreoreoreorer saasasalesleseses anand sd sd sd seameameameameamlesleslesesslysly ruruur n tn tn tn theiheiheiheir rr
busbusssineineineneessessssessesses—fs—s—fs—ffromromromromm shshshsshippippppppppinginginginging anannnd td td td tracracccckinkinkinkinking ig ig ig ig itemtemtemtemtems ts ts ttoo o
manmananmanm agiagiagingngngg invininvnvinvententententtoryoryryoryory, rr, rrrunnunnunnnnun inginginging adadadadd cacacacampampampampapaignignignignigns as aas aandnddndnd
proprpromomotmotmotm ionionions, s, s, crecrecrecreatiatiatit ngngngng beabeabeabeaeaututiutiutut fulful cucucuuustststoststom m wm wm wm ebsebsebsebseb iteiteees, s,
andandndnd eveeee enenee booboobooboobookkekkekkekkekkeepiepiepiepipingngng gng andandandandnd acacacaca coucoucouocountintintntinting.ng.ng.nng.
* AAAAccoccoccoordirdirdirdir ng ngngngg toto to o a 2a 2a 22018018018018 sususuurververveveey oy oy oy of Ef Ef Ef EEtsytsytsysyy bubububuyeryeryeryerrs.s.s..s
***** ActActActiveiveiveive sesellellersrs asasasass of ofof of DecDecDecDecembembembee
er er ee 31,31,31,3131 20222 18.18.188.18.
4th4th4th4th ofofff JuJuJuulyy
ThaThaThaThanksnksnksnksgivgivgivgivingingnging
LabLabLabLaboor or or o DayDayDayDDay
HalHalHallowlowlowoweeneeneeneene
July
August
September
October
November
December
HavHavinginining a aa babbabbabb yyy
BacBacBacBa kk tk o so so so chochchochochooololo
SpeSpeSpep ciaciaciaal ddddl dresreseressss
Holiday
6
Strong financial and
operational performance
In 2018, we continued to nurture
and invest in our marketplace.
As a result, we connected more
buyers and sellers than ever
before, and delivered a strong
performance across important
financial and operating metrics.
Our vibrant community includes people buying
and selling in nearly every country in the world.
Active sellers
grew 9.4% to 2.1 million*
Active buyers
grew 18.2% to 39.4 million*
*As of December 31, 2018.
Gross Merchandise Sales (GMS)
Revenue
$3.93B
35%
$3.25B
33%
$2.84B
30%
$2.39B
30%
70%
70%
67%
65%
$604M
$441M
$365M
$273M
2015
2016
2017
2018
2015
2016
2017
2018
GMS growth accelerated to
20.8% in 2018 compared to 2017.
% Domestic GMS
% International GMS
Revenue growth accelerated to
36.8% in 2018 compared to 2017.
201201201201220120120120120100 8 I8 I8 I8 I8 I8 I8 8 88 Intentententententententetn gragragragragragragragragratedtedtedtedtedtedtedtedtedde ReReReReReReReReeReReporporporporporporporporporp ro tttttttt
7
A long runway for
sustainable growth
With more and more people around the world
choosing to purchase goods online, we believe
we are in the early stages of our opportunity and
that we have a large addressable market.
2018
Retail and online total
addressable market
$1.7T
Total retail and online spend in all relevant
categories in our six core geographies
Top geographies:
United States
United Kingdom
Canada
Australia
Germany
France
$249B
Online spend in these
categories and geographies
Etsy’s 2018
GMS represents
under 2% of this
$249 billion
market
Sources: Euromonitor (2018), Assoc. for Creative Ind. (Jan. 2018), Art Basel (2018), Hiscox (2018), IBIS.
WWWWWeeeee bbbbbeeeellliiiieeevvveee wwwwweeeee aaaaarrreeeee wwwweeeeelllllllll pppppoooosssiiittttiiiiioooonnnnneeeddd
tttooooo cccaaaaapppiiittttaaallliiizzzeeeee oooonnn ooooouuuurrrrr lllllaaaaarrrgggeeeee mmmmmaaaaarrrkkkeeeeettttt
ooopppppppooorrrrtttttuuuuunnnnniiitttyyy.. EEEEEtttsssssyyyyy ssstttaaannndddsssss ooooouuuuttt iiiiinnnnn
aaaaa ssssseeeeeaaaaa ooooofff sssssaaaaammmmmeeennnnneeeeesssssssss bbbbyyy oooffffffffeeeeerrriiiinnnnnggggg aaaa
dddiiiiiffffffffffffeeeeerrreeennntttiiiiiaaaaattttteeeeeddd eeexxxpppppeeeeerrriiieeeennnccccceeee,,,,, ooooonnnnneeee ttttthhhhhaaaaattttt
iiiiisssss rrrrooooooottteeeedddd iiiiinnnn hhhhhuuuuummmmmaaaaannnnn cccoooonnnnnnnnnneeeecccccttttiiiooonnn
aaaaannnnnddddd ccccrrrrreeeaaatttiiivvvvviiittttyyy. BBBBByyyyy llllleeeaaaaannnnniiiiinnnnnggggg iiiiinnnnntttooo
ooooouuuuurrrrr cccccoooommmmmpppeeetttiiiiitttttiiiiivvvvveeeee aaaaadddddvvvvvaaaaannnnntttttaaaaagggeeeesssss,,,,,
wwwwweeeee ssseeeeee aaa ssssiiigggnnniiiiififififificccccaaaaannnnnttttt rrrrruuuunnnwwwwwaaaaayyyyy fffffooooorrrrr
sssssuuuuusssstttaaaiiinnnnaaaabbbbbllleeeee lllllooooonnnnnggggg---ttttteeerrrrrmmmmm gggggrrrrrooooowwwwwttttthhh:::
uniuniuniunun quequeque “R“R“Righighighhht tt ttt t to Wo Wo WWWin”in”in”nn”
untuntuntuntntappappappappappeeededed oppoppopportortor uniuniunitietietietieies s ss s
ininininin proprprproproducducducducduct dt dt deveeveeveeeloploplopopopmenmenmenmenmenme tttt t
andananandand mamamamamarkerkerketintintini g ig ig ig ig invenvenvenvenvesstmstmstms
entententee
besbesbesee t-it-it-in-cn-cn-cn-cn-claslaslaslaslass ts ts ts ts techechechnolnolnololologyogyogyogyogy
disdisdisd cipcipcipcipciplinlinlinned ed ed ede lealealealeaeaderderdererershishiship tp tp teameameamee
andandandandand hihihih gh-gh-gh-h-h-pperperperp forforforfofo manmanmananncecececece culculculculculturturturturre
8
M
R
E
T
-
G
N
O
L
R
U
O
L
A
O
G
D
R
A
W
O
T
G
N
I
K
R
O
W
E
R
A
E
W
T
A
H
W
9
1
0
2
N
I
Having a
positive impact
We are committed to using the power of business as a
force for good in the world. Our impact strategy outlines
the specific ways we seek to generate positive economic,
social, and ecological value for our community and our
stakeholders in a way that advances and supports our
long-term business strategy. We believe in cultivating
a virtuous cycle where our impact drives our business
and our business drives our impact, working together to
advance our broader mission to Keep Commerce Human.
Our strategy for impact
Economic impact
Social impact
Ecological impact
Make creative
entrepreneurship a path
to economic security and
personal empowerment.
Enable equitable access
to the opportunities that
we create.
Build long-term resilience
by eliminating our carbon
impacts and fostering
responsible resource use.
Double U.S. Etsy sellers’
economic output by 2023.
Invest in social programs
that foster economic
security and personal
empowerment for
our stakeholders.
Advance public policies
that increase economic
security and reduce
administrative burdens for
creative entrepreneurs.
Approximately double
the percentage of Black
and Latinx employees in
Etsy’s workforce by 2023.
Build a diverse, equitable,
and sustainable supply
chain to support our
operations and bring
value to both Etsy and
our vendors.
Make Etsy a more
inclusive and welcoming
marketplace for people
from underrepresented
backgrounds.
Utilize and source energy
responsibly so that we can
power our operations with
100% renewable electricity
by 2020 and reduce the
intensity of our energy use
by 25% by 2025.
Mitigate the ecological
impact of our marketplace
by offering carbon-neutral
shipping on 100% of
transactions by 2020.
Run zero waste
operations by 2020.
2012018 I8 I888 ntententeeeentetet grgragragraraggraagragraggrgragg atedttetedtetedtedtedtettttetedtted RReReReReReRReporporpoporoororttttt
99999
Empowering creative
entrepreneurs around
the world
AAAAAAAAAAAAAAAAAAAttttttttttttttttt EEEEEEEEEEEEEEEEEEtttttttttttttttttttsssssssssssssssyyyyyyyyyyyy,,,, wwwwwwwwwwwwwwwwwweeeeeeeeeeeee llllllllliiiiiiiiiiikkkkkkkkkkeeeeeeeeee ttttttttttoooooooooooo ssssssaaaaayyyyyyyyy ttttttthhhhhhhhhhhaaaaaaaaaaaaatttttttttttt eeeeeccccoooooooooooonnnnnnnnnnnooommmmmiiccccc
eeeeeeeeeeemmmmmmmmmmpppppppppppppoooooowwwwwwwwwwwwwwwweeeeeerrrrrrrrrrrmmmmmmmmmmmmmmmmeeeeeeeeeeeeeennnnnnnnntttttttt iiiiiiisssss ooooouuuuuuuurrrrrrr dddddddddddddddddddaaaaaaaayyyyyyyyy jjjjoooobbbb.. IIInnn oooooooouuurrrr
mmmmmmmmmmmmaaaaaaarrrrrrrrrrkkkkkkkkkkkeeeeeeeeeetttttttttppppppppppppppppppplllllllllaaaaaaaaaaaaccccccccccccceeeeeeeeeeeeeeeeeeee,,,, ccccccccccccccccrrrrrrrrrrrrrreeeeeeeeeeaaaaaaatttttttiiiiiiivvvvvvvvvvvviiiiiiiiiiiiittttttttttyyyyyyyyyy ccccccccaaaaaaaaaannnnnnnn tttttttuuurrnnn iiinnnnnnnnntttttooooo aaaaaa
ttttttttthhhhhhhrrrrriiiiiiivvvvvvviiinnnnnnnnnggggggggggg bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbuuuuuuuuuuuuuuuuuuuuuuuuuussssssssssssssssiiiiiiiiiinnnnnnnnnnnnnneeeeeeeeeeeeeeeeeeeessssssssss.. WWWWWWeeeeeeeee bbbbbbbbbbbbbbbbbbrrrriiiiiiinnnnnnnnngggggggggg ooooooouuuuuuuurrr ssseelllleeeerrrssss
mmmmmiiiilllllllliiiiioooooooonnnnssss oooooooooooffffffffffffffff bbbbbbbbbbbbbbbbbbuuuuuuuuuyyyyyyyyyeeeeeeeerrrrrsssss aaaaaaannnnnnnndddddddddd ppppppppprrrroooooooovvvviiiiiddddeeeeeee ttthhhhhheemmm
wwwiiitttttthhhhh tttttttoooooooooooooooollllssssssssssss aaaaaaaaaaaannnnnnddddddddddddd ssseeeeerrrrrrvvvvviiiiccccccceeeeeeessssssssss tttttttttthhhhhhhaaaaaaaatttttttt mmmmmmmmmaaaaaaaakkkkkkkkeeee iiiiiittt eeaaasssssyyyyyyyyy
ttttooo rrruuuunnnnnnnn aaaaaaaaaaaa bbbbbbbbbbbbuuuuussssssssssiiiiiiiiinnnnnnneeeesssssssssssssssssss... BBBBBBBBuuuuuuuuuuuttttttt oooooooouuuuurrrrrrrrrr sssssuuuuuuppppppppppppppppppppoooooorrrrrrrttttttt ddddddddddooooooeeeeeeesssssssnnnnnn’’’’ttttttttt
eeeeeeeennndddd tthhhheerrrreeeeeeeee. FFFFFFFFFFrrrrrrroooooommmmmmmmmm aaaaaaaddddddddvvvvvvoooooccccccccccaaaaaaaaaattttttiiiiinnnnnnnnnnnnggggggggggg fffffffffffooooooooorrrrrrr ppppppppuuuuuubbbbbllliiiiiccccc
ppppppppppppppppooooooollllliiicciiiieess tttthhhhaaaaatttt iiiinnnnnnnnnnccccrrreeeeeeeaaaaassssssseeeee eeeeeeeeccccccccoooooooooonnnnnnnnnnnooooooooooommmmmmmmmmmmmmiiiiiiiiiiccccccccccc ssseeeeeeccccccccuuuuuuurrrrrrriiiiitttttyyyyyyyy
tttttttoooooooo ppppppppprrroooovvviiidddiiiiiinnnnnnggggggg fififififififififinnnnnnnaaaaannnnncccciiiaaaaaaalllll rrrrreeeelllllliiiiiiieeeeefffff wwwwwwwwhhhhhhhhhhheeeeeeeeennnnnnn ddddddddddiiiisssssssaaaaaaassssssssttttttttteeeeeeeerrrr
ssssssssstttttttttttrrrrriiiiikkkkkkkkkkeeeeeessssssssss,,, wwwwwwwwwweeeeeeeeeee hhhhhhhhhaaaaaaaaaavvvvvvveeeeeee ooooooooouuuuuurrrrrr sssssseeeeeeelllllllllllllllleeeeeerrrrrrsssss’’’ bbbbbbaaaaaaaccccccckkkkkkkkkkssss..
AAAAAAA pppppppppppppppoooooowwwwwwweeeeeeeeerrrrrrrrfffffffffuuuuuuuulllll pppppppppplllllllaaaatttttffffooorrmmm fffffooooorrrrrr eennnnttttrrrrrreeeeeeppppprrreeeennnnneeeeeeeeuuuuuuuuurrrrrrrrrssssssss
AAAAA rrrrrrriiiiiiiiiippppppppppppplllleeee eeeeffffffffffeeeeccccttt
EtsEtsEtsEtssEtsEtsEtE y y sy sy sssyyyy ellellellellellellellele ersersersrssrserrs atatatatt aaaaa glancecncece
2.1M
actactactactactaac iveiveiveiveiveveivevevve EtEtEtEtEEEtEtttsysy sy sy syssys selselselselselelselellerlerlerlerlererere s*s* s* s*s*s
87%
of ofof oofof ofofo EtsEtsEEtsEtsEtsEtsEtsy sy sy sy syy sy sellellellellel ersersrrsers arararare we we we we we we we womeomeomeomeomeomeeomen.*n.*n *n.*n.*n.*n.*n.******
By By ByBBy By y y By comcomcomcomcomcomcomcomparparparparppaaparisoisoisosoisi n,n,n,n,n 35%35%35%%5%%5%35% ofofofofofofo fififififf rmsrmsrmsrmsmm
gloglogloglogloglogloglobalbalbalbalbalbababa ly llyly havhavhavhavavhavhave we we we we wwe wwomeomeomeomeomeomeomeomen in in in in in inn innnnnn
ownownownownownownwnownersersersersersshiphiphipiphiphip popopoooopopositsitsitsitsitsitsits ionionionionionions**s**s**s**s**s*********
97%
rrurunrunrunn ththththhhtheireieireeir shshshhopsopsopsopsopsopsopss frfrfrfrffrfrom omomom om om om mm
thethetheheeheir irir rr homhomomhomommes*es*es*es*es*eess ****
80%
arearearea erear aaaaa busbusbusbusbusineineneneess ss ss ss ss sss of of of of of oof f oneoneoneoneoneoneoneoneonen ***************
28%
ofofofofofo elselsele lerleerlerere ls ls ls ls liveiveiveiveiveveveeev ininnininininininn
rurrurrurruuu alalala areareearerr as*asas*s*s*as ******
53%
ofofofofofofofofo selselselselselselselsssssellerlerelerelerlerers fs fs fs fs fs firsirsiirsirirrst st st ssssoldoldoldoldoldoldolddold
thethethethetheththetthehth ir ir ir iririr irr googoogoogoogoogoogoogooods dsds dsdssds ss ononononononnonn EtsEtsEtsEtsEtsEtsEtE sy**y**y**y**y**y**y***y****y**
InInInInInnnIn 20201201201200 8,8,8, wewewewewe e we helhelhelhelehelhelehelhe pedppedpedpedpedpededpedpedped gigiggigigigigigigigigig veve ve ve ve vevveveve crecrecrecrecrecrecreeecrecrecrecr atiatiatiatiatiatatatiat veve veve ve veveveveveeeee entententenenenteneeeneenn repreprepreprepreprere renrenrenrenrenrenreneureureureurureueue s as as as as as as aaaa vovoovovovovovoooiceiceiceiceiceiceiceceiceeicecc ,, , ,,,,,
aas as as aaas EtsEtsEtEtstsEttsy sy sy sy sy ssellellellellelllllllersersersersersersersrsrssr sesessseseseeent nt nt ntntnttttt 14014014140140140140140140440,00,000,00,00,00,0000,000000000000 m0 m0 m0 m0 m0 m0 m0 m0 m0 m00000 m000 m0 essessessessessesessessessagageageageageageages ts ts ts ts tss to po po po po pppo poliolioliolioliolioliolicymcymcymcymcycymycymcymakeakeakeakekakeakeakeakek rsrsrsrsrsrsrsss
ononononon issississsssuesuesuesues rararararaaangingngngingingingngingn ng ng ng ng ngng gng frofrfrofrofrofroror m nm nm nm nm nnetetetetetetee neuneuneuneuneun tratratrararalilititlitlitli y ty tyy ty ty oo to to to tax ax aax axax faifaifaifaifaifaiirrnernernernernenrnerness.ss.ssss.ss.ss.ss.
WWe We We WWeWeWe alsalsalslsaa o go go go go ggaveaveavveaveaveeveve $2$2$2$$2$2228080,8080,8080 0000000000000 inininin chchchcchc aririiariara tabtabta lelelele gifgifgiffgifgifts ts tts ts t to to to to to o supsupsupsupsupsu pporporpporoo ttt
ourouroururouoouou lololoooloocacacalcalca cocococoommummmmummummumm nititnitiesiess ananananana d cd cddd d reaeae tivve ee ee ntrntrntrntrntrt eprepreprreprep eneeneeeneeneeneeeeeeeeeeeeeeeeeeee ursursursurs inin neeed.ded.d
EtsEtsEtssEtsy’sy’sy’sy’sy’sy’sy ececcceconoonononooonoon micmicmicccccccmic imimimimmmimmpacpacpacpacpacacact ett et et et et et etttt xtextexxxtxtexxtendsndsndsnd bebeyonnyonnd td ttd tthe he he he hehe hehee salsasalsasalsalsalsasalsalsalls eseseesesesesese
thathathahaaathat ot ot ot oooot our ur urur rururr marmamarmarmarmamarketketketetk plaplaplaplaplaplaplaplaplaplaace cecececececece enaeenaenaenaenene bleblebleblebless. s. s. s.ss SelSelSelSelSelS lererlers ps ps pppay ayay ay ayayay forforforrorforor sususususususususupplpplpplpplpppplpppplpplpplp iesiesiesiesiesesesiesiesiesiesee ,,,,
pospospospospospospospospoposspostagtagtagtagtagtagtagagagagge, e, e, e, e,e, e, renrenrenenrenenrennennnt, t, t, t, t,t,t, t,, thethethethethettheeeirir ir iririi tataxtaxxtaxxxes,es,es,es,es,ee ananananandd cd cddd compompo
empempempempempmpemppmpeempe pployloyloyoyloyloyoyoyloloyeeseeseeseeeeseeseeseseess, a, a, a, a, a, a, a, a, aa, aall ll ll llll llll l of of of of oof ofo whwhwhwwhiwhiwhihihwhiwhwwhiw chchchchchchcchhhc dridridridridridrdridrid vvvesvesvesevesv
AccAccAccAccAccAccAccAccccAccAccAcccccccccordordordordordordordordrdordordordrdr inginginginginginginginginginningnnnnnn totototototototo ououououououououououourr err er er er er eeer eeer conconconcoconconconconconnconnconnomiomiomomiomiomiomiomiomiomioom c ic ic ic ic ic ic ic c c c mpammpampammpmpmpampampampmpp ct ctt tccctt stuststutustustustustustsstudy,dy,dy,dy,dy cococococococondundundundundundundundundud ctectectectectectectectecteeed dd dddddd dd
by bybybbbybybybby by byy byy ECOECOECOECCECOECOECOECOECOECOCECECOCECOCECEE
tththttheireirireirir
ensenssateateateat
ececece onoonooooo micmicmicmicm acacacaactivtivtivitiviivityityityityityityityityity..
.S.S EtEtEtEtEtEtsy syy sy sy syy selselselselseseses lerlerlerlerlere s:s:s:s
.S.
.S.
i, i, i ii, i, ii, in 2nn 2n 2n 2n 2n 2n 2nn 201801801018018001018018188800 88, U, U, U, U, U, U, U, UUU, UU S.S.
.S.
NorNorNorNorNorNoNorNorNorNorNorthwthwthwthwthwthwthwthwwwthwwthwestestestestestestesteststestestesse
•••••••• ConConConConConConConnCononConConnnnnnnonnnnnConntritritritritritritritririttrittttrittttritt irit butbutbutbutbutbutbutbutbutbutbutbutbubutbubutbubb edededededededededededdeed $5.$5.$5.$5.$5$5.$5.$5.$$$5.$$5 37 37 37 37373737 373737737 bilbilbilbilbilbibilibbibb lioliolioliolioliollion tn tn tn tn tn tn to to to to to to to the hehehe heehe he heh U.SU.SUU.SU.SU.SUU.S. e. e econconconcononononomyomyomyomymyomyomymm , mm mmmmmmmmmoreoreoreoreoreoreoreoreooo
thathathathathathathahathathaathahaaaaathaaan dn dn dn dn dn ddn dn dnnnnn dn dn dnnnn ouboubouboubouboubouboubouboububboububuubbuu leleleleleleelleeeeee thethethethethethethethethethetheeee riiririririririrrirr dirdirdirdirdirddirdiddirdidd ectectectectectectcteccectec bubububububbub sinsinsininsinsinsinsini essessessessssessssss sasasasasasaaaalesleleleslesses
•••••••• CreCreCreCCrCreCrCreCreCreCreeateateateateateateateateateateat d 1d 1d 1d 1d 1d 1d 1dd 1d 1d 1 dddd .52.5.5.52.52.52.52.525252.52.5 mimimimmimimmmm llillillillillillilllil on on on onoonon on nn jobjobjobjobjobjobbobobs is is is is is is ss is in tn n tn tn tn tn tnnnn hehehehehehehhhhhh indinindinddindepeepepeepeependendendendeded ntnn worworwoorororrwoo kerkerkerkerkkerkk
ecoecoecoecoecoecoecooecooc nomnonomnomnomnomnomnomnomnomnnomonnomyy,yy,y,y,yy,y,y,y,,y,y, eneneeneneneneneeneeeee ougougougougougou h jh jh jh jh jh jh jh jobsobsobsobsobsobsbobsobob tototototototo eemememememememee ploploploploploploploppplploploy ty y ty ty tyy thhhe hehe he entententtttireireirireirre ciciiicicitytytytyty
of of oofof ofoof fooo SanSanSanSanSanSanSanSanSSanaSan AnAnAnAnAnAnAnAnAnnAnAAA tontontontontontontonontontonttont
ioio
io
io
io
ioio
•••••• GenGenGenGGenGGenGenenGenGGenennneraeraereraeraeraeraeraerareraeraar tedtedtedtedtedtedtedtedtedtetededeee momomomomomomommmm rere rerereeeereere thathathathathathathathathat n $n $n $n $$n $$n $$$$1.71.71.71.77711.776 b6 b66 b6 b6 b6 bbillilliliillillioniononionooi
ininiinn ininininnincomcomcomcomcommmeeeeee
••••••••• ProProProProProroProProProProPrP ducducducducducducucducducdududuucd ed ed eded eeeded d $3 $3 $3 $3$3 $33$3$3$333 bilbilbilbilbilbbillioliolioliolioliooliolioliolioon in in in in in in in in innn n n an n an an n an an ann ddiddidddiddiddddddid ttiotiotioionalnalnalnalalalll ecececececcceeeconoonoonoonoonoonoonoon micmicmicmicmicmicm vvavavaaavaaavallueluelueluuueuuuuuu
ityityityityityity anananananand bd bd bd bd bd bd bd brinrinrinririnrinrininginginginginginginginging g ug ug ug ug ug uggg niqniqniqniniqniqniqniqniqnn qn qqque ue eueuu
bybybybybybybybbbybybyb harharharharharhararharharharh nesnesnesnesesnessesseessinsinsinsinsinsinsinsinisss g tg tg tg tg tg tgg ttg theiheiheiheiheiheheihe r cr cr cr cr cr ccr ccr creareareaearearearereareareativtivtivtivvtivttit
proproproproproproppropproprp ducducducducducducducd tststststststs to to tototo to to marmarmarmarmarmarmamararara ketketketketketketketetketketetekettketketketketketketketketeketketketeee
ForForForForForForFo momomomooomomomomore rerere re rerr detdetdetdetdetdetddetettailailailailailaila ls os os os os os ooon on on on on o on on on o our uur ur ur ur uur ecoecoecoecoecocoonomnomnomnomnomnomnommmmicicicc impimpimpimpimpimim actactactactctact wowowowoowooow rk rkrk rk rk rkkkkkkkk andnandandandanandnn
recrecrecrecrecrecrececrececenententenenenteeeenn prprprprprprprrrogogogrogrogrogrogo essessessessesssssssssss, p, p, p, p, p,
papapapppap ge gege ge gege gegee 16 16 1616 16 161616 of of ofof of oof of of ourourourourouroururour 101010100-K.-K.-K.-K.K.K
lealealealealealealeaeaeaeae sesesese se seseesee seeseeseeseeseeeeesss
..
berber ber ber ber beeb 31, 31, 33 20180180180182
*A of Dof Dof Dof Dof Dof DDof Df DDDof Dof Decemecemecemecemecemeee
*A*A*As*As As*As As A*As
*As As As
**Ac**AcAc**Ac**Ac**Ac*Ac*AA**Ac**Ac**AccccAA cocordcococordcordcordcoco ing
inning to oto oto oto o oto ur 2rrur 2ur 018 0188 sellsellsellseller ser ser sr ser srr urveurveurveuru
ing nging
c o dingdingdingingdiingdingng to to to ootototoo TheTheThThhhhT WorlWoWW d Bad Bad Bad BaBad
ccor
ccccor
ccor
ccoccor
***A***A***A***A***A***A***A***A*A**AAAAccor
y.yy.
rvey ononononononnn GendGendGendGendendGendGGendder,er, er, er, er, 20200182018020 .
rvey
rvey
nk Enk Enk Enk Enk Enternternternterernn rprisprisprprise Su Sue Sue Sue Survey
10
Nurturing a culture
of diversity and inclusivity
Nurturing a culture of diversity
and inclusivity has always been
a part of Etsy’s DNA. Embracing
diverse perspectives makes us
stronger, more resilient, and enables
us to be the best we can be.
We continue to look across all of our processes
and the entire employee life cycle to ensure
that we welcome and support people of all
backgrounds, genders, races, ethnicities, sexual
orientations, ages, life stations, and abilities.
We’re proud that Etsy is a leader within our industry
in terms of gender diversity. As of December 31, 2018,
women comprised:
56%
of our overall
employee base
52%
of all leaders (Director
level and above)
50%
of our Board of Directors and
the majority of our Executive Team
33%
of engineers
BBBBBBBBeeeeeelllllloooooooowwwwwwww aaaaaarrrrrreeeeeee aaaaaaaa ffffffffeeeeeeeeeewwwwwwwww eeeeeeeeexxxxxxxxxaaaaaaaammmmmmmmmppppppppplllllleeeeeeesssssssss
oooooooofffffff oooooouuuuuurrrrrr dddddddiiiiiivvvvvvvveeeeeeeerrrrrrsssssiiiiiiitttttttyyyyyyyyy aaaaaaaannnnnnnnnndddddddd
iiiiinnnnnnnccccccclllllluuuuuuussssssssiiiiiiiooooooonnnnnn eeeeeeeeeeeffffffffffffffffffooooooooorrrrrrrtttttssssssss::::::
ll ll ll llll cancancancancannndiddiddiddiddiddiii ateateateeateatet sssssss
CreCreCreCreeCreatiatiatiatiingngngngngng hirhirhirhirhirirringinginginging
rubrubrubbrububbricricricricricrics ts ts ts ts ts o eo eo eo eo eo nsunsunsnsunsuuurerereeere
thathathathath t at at at at a
areareareareree evevevevevalualualualualulul ateateateateateateeetedddd
rlyrlyrlyrlyrlyrlyyy anananananaanaa d wd wd wd wdd wd wd wwithithithititii
faifaifaifaifaifaiff
objobjobjobjobjbjectectectectctectctctiveiveveiveivevevev crcrcrcrcrccriteiteiteiteiteiteeteriariariairiariariai
IncIncIncIncccrearearereaaasinsinsinsinsinsing og og og og og our uruurur urururu
tartattartartargetgetgetgetgetg ededededee recrerececeecrecruiruiruiruiruiruiruu tintintintintinting g g g gg
effeffoeffoeffoeffoeffoeff rtsrtsrtsrtsrtttss tototototooot
cancacaancananancannndiddiddiddiddidi ateateatetteatetes fs fs fs fffs fs fsss romroromromromromomoro
undundundundundunununnn ererrerrreprepreprepreprprreseeseeseseeseseeseee ntententent dd dd ddddd
bacbacbacbacbacbaccccckgrkgrkgrgrkgrkg ounounununuounouo dsdsdsdsdsdsdsdssd
rerererreeachachacacachachchachh
ForForForForForFo momomomomomoom rererererere detdetdetdetetdetetailailailailailails os os os os os on on on on oour ur ur ur r socsocsocsocsocss
recrecrecrececrecentententententeneent prprppprprprprogrogrogrogrogrogrogrogressessssssessess, p, p, p, p, pplelealealeaaase sese se ss seeseeeesees
ial imimimmimpacpacpapapacpacaa t wt wwt wwwt workorkorkorkorkorkrkrkork ananananannnd ddd d
ial
ial
ial
ialal
papapapapaagge ge geeeg 17 17 17 117 of of ofofo ourooourouourourour 10101010100-K.-K.-K.-K.-K
inginginginn mamamamamaaanagnagnagnagnnagersersersersrerss
ProProProProPror vidvidvidvidvi
witwitwitwitwittth hh hh hh hhh hh hhh ighighighighighighhly ly ly yly l
antantantantntanntnn i-di-di-d-d-dddii
antantantantantanttti-hi-h-hi-hi-haraaraaraaraaraararassmssmssmssmsmsss entententententententnntnnn trtrtrtrtrtrainainainainaina niningingiiingingingnnninn
iscisciscisciscissccrimrimrimririmrimriminainainainananananaatiotiotiotiotioon an an an aan annn ndnd nd nd ndndd
intintintintintintninteraeraeraeraerare ctictictictictittt vevevevee
ImpImpImpImpImppImpmpmpmpplemlemlemlemlemementententeententententnttingingingingngingingi
aaaaaaa mormormormormormormorormororeeeeeeeeee
forforforforforforfororformalmamalmalmalmalmaamm cococococoococompampampampampampampampampapanywnywnywnywnywywnywnywwny idideidedeidededededed
perperperpererererrforforfororfororfoforffo manmanmanmanmanmanmanm ce ceccececececce
mmamanmmanmanmanmma ageageageageageageaagemenmenmenmenmenenmenmennm t pt pt ppt pt pt pt pt procrocrocrocococrocrrocessessesessessesessee
to to to tto supsupsupsuppsuppoporporpoorororrortt t ct ct ct ct t consonsonsonsonsonsnsonsonsistististististististististenentententenntententt
andandandandandandandand fafafafafafafafafairirrirr eevaevaevaevaaaevaevae lualualualulluauu tiotiotioootiot nsns nns nnsnn
SupSupSupSupSupSupSupSSSupSuSu porporpoporrrporororpo tintintintintintininng ag ag ag agg andndnddndddd proproproroproproroprororomotmotmotoomomotmmmm ingingingingngngngg
empempempempempmpmpempempemppemppployloyloyloyoyoyloyloyloyloyoyeeeeeeeeeeeeeeeeee resresresssererr ourourourouroururouroourcecece ce cecece grogrogrogrogrgrogrogrorr upsupsupsupsupupuu
(“E(“E(“E(“E(“EE(“E(“E“(“E(“ERGsRGsRGsRGsRGsRGsRGsRGssRGs”)”)”)”)”)””)) in
lldld dddd
iniininnn ordordorordorordo eer er errerrerer totototototototoo buibuibuibuibuibuibubbu ld
ld
ininin
a sa sa sa sa sa sa ssensensensnsensensnsnseeen e oe oe oe oe oeee oe oe e f cf cf cf cf cf cf cff ccommommomommmmommommommommmuniuniuniuuniuniuniuninnity,ty,ty,ty,ty,tytytty,
devdevdevdevdevdevdevdddeded eloeloeloeloeloloeloeloeel p np np np nnp npp neeewewwwewww leaeaeaeallee derderedererererders,s,ss,s,ss anandandandndandandananand
ampamamampampampampampamppliflifliflififliffffy dy dy dy dy dy dy dy ddy diveiveiveiveveveiivev rsersersersersesesee vovoovovovovoiceiceiceceiceicececes s s s
witwitwitwitwitwitwitwitwithinhinhinhinhinhihhinhh EtEEtEtEtEEttsysysyysysysysysy
2018 Integgrated Report
11
Protecting our planet
In the face of a changing climate,
we believe in being proactive in how
we manage our resources. In 2018 and
early 2019, we reached several key
milestones that moved us closer to our
goal of building long-term resilience
by eliminating our carbon impacts and
fostering responsible resource use.
Carbon-neutral shipping: 98% of Etsy’s total
emissions stem from items shipped from our sellers
to our buyers. Although we do not actively manage
this shipping process, we believe we should hold
ourselves accountable for the environmental impact.
That’s why in February 2019, we became the first
global ecommerce company to offset emissions from
shipping.* Each time someone makes a purchase on
Etsy, we automatically purchase verified emissions
reductions through a third-party partner.
These purchases, which cost Etsy less than one
penny per package, support environmental projects,
including protecting forests that improve air quality and
absorb carbon, sponsoring wind farms that generate
clean energy and replace fossil fuels, and developing
greener methods for producing auto parts. Offsetting
our shipping emissions is an important milestone
as we work toward a long-term reduction solution.
And although we’re the first global ecommerce
company to take this step, we hope we are not the last.
Procuring power from sustainable sourcees:
In August 2018, we announced that we weere joining
Apple, Akamai, and Swiss Re to procure poower
from new solar and wind energy farms. Thhis virtual
power purchase agreement will allow us too drive
a larger, more positive environmental impact than
we would have achieved individually. We pplan to use
the renewable energy from this agreemennt to help
power our operations and computing infraastructure,
furthering our goals of creating a cleaner internet
and reducing our impact on the planet.
Migrating to the cloud: In 2018, we kickedd off our work
on transitioning from our own data centerr infrastructure
to Google Cloud Platform (GCP). Moving to flexible
cloud-based infrastructure allows us to redduce energy
consumption. This is a key step toward reaaching our
sustainability goal of reducing our energy consumption
and powering Etsy with 100% renewable eelectricity
by 2020.
Zero waste operations: We’re proud to havve achieved
our goal of running zero waste operations globally in
2018, two years ahead of schedule. In 20188, we diverted
95% of waste from landfills or incinerationn across our
offices globally, well above the 90% threshold to be
considered “Zero Waste.”
For more details on our ecological impact work and
recent progress, please see page 18 of our 10-K.
*According to research by 3Degrees.
O ur ec o s y s t e m
Our co m
y
n i t
u
m
s
s
e
ur b u si n
O
Sellers
Turn their creativity
into thriving
businesses by
connecting with
a global community
of buyers.
12
Integrated
value model
Through our efforts to nurture our
marketplace and drive a positive
impact, Etsy creates value and
empowers people every day.
Our ecosystem
Includes a set of external
factors that support our
success, such as: a strong
ecommerce foundation; access
to clean, renewable energy;
laws that allow creativity and
entrepreneurship to thrive; and
a healthy natural environment.
Our community
Is filled with not only our buyers,
sellers, and employees, but all
of those who make it possible
for us to live our mission.
Our business
Is a trusted marketplace where
sellers can grow and pursue their
creative businesses and buyers
can find unique and special
items. This is all supported by our
passionate team at Etsy.
Photo by Name Here
Buyers
Discover a universe
of products that
help them express
themselves
and support
independent
creative businesses.
Etsy, Inc.
Continuously invests
in our people, and
the platform, to grow
a vibrant, creative
marketplace.
2018 Integrated Report
1313
Our ecosystem
Is an environment that
supports and nurtures creative
entrepreneurship.
Our community
Empowers people who
come together to Keep
Commerce Human.
Our business
Delivers more joyful moments to
buyers, empowers more creative
entrepreneurs to build successful
businesses, and fosters the talents
and careers of Etsy employees.
When everything is working together the
way we envision, the result is financially
empowered sellers, delighted buyers,
a strong and vibrant team of employees,
and a healthy planet—all contributing
in their own unique way to fulfilling
the Etsy mission.
[ T H I S P A G E I N T E N T I O N A L L Y L E F T B L A N K ]
UNITED STATES
SECURITIES AND EXCHANGE COMMISSION
Washington, D.C. 20549
_________________________
FORM 10-K
_________________________
Annual Report Pursuant to Section 13 or 15(d) of the Securities Exchange Act of 1934
For the fiscal year ended December 31, 2018
OR
Transition Report Pursuant to Section 13 or 15(d) of the Securities Exchange Act of 1934
For the transition period from to
Commission File Number 001-36911
_________________________
ETSY, INC.
(Exact name of registrant as specified in its charter)
_________________________
Delaware
(State or other jurisdiction of incorporation or organization)
117 Adams Street, Brooklyn, NY
(Address of principal executive offices)
20-4898921
(I.R.S. Employer Identification No.)
11201
(Zip code)
(718) 880-3660
(Registrant’s telephone number, including area code)
Securities registered pursuant to Section 12(b) of the Act:
Title of each class
Name of each exchange on which registered
Common Stock, par value $0.001 per share
The Nasdaq Stock Market LLC
Securities registered pursuant to Section 12(g) of the Act: None
Indicate by check mark if the registrant is a well-known seasoned issuer, as defined in Rule 405 of the Securities Act.
Yes
No
Indicate by check mark if the registrant is not required to file reports pursuant to Section 13 or Section 15(d) of the Act.
Yes
No
Indicate by check mark whether the registrant (1) has filed all reports required to be filed by Section 13 or 15(d) of the
Securities Exchange Act of 1934 during the preceding 12 months (or for such shorter period that the registrant was required to
file such reports), and (2) has been subject to such filing requirements for the past 90 days. Yes
No
Indicate by check mark whether the registrant has submitted electronically every Interactive Data File required to be submitted
pursuant to Rule 405 of Regulation S-T (§232.405 of this chapter) during the preceding 12 months (or for such shorter period
that the registrant was required to submit such files). Yes
No
Indicate by check mark if disclosure of delinquent filers pursuant to Item 405 of Regulation S-K (§229.405 of this chapter) is
not contained herein, and will not be contained, to the best of the registrant’s knowledge, in definitive proxy or information
statements incorporated by reference in Part III of this Form 10-K or any amendment to this Form 10-K.
Indicate by check mark whether the registrant is a large accelerated filer, an accelerated filer, a non-accelerated filer, a smaller
reporting company or an emerging growth company. See the definitions of “large accelerated filer,” “accelerated filer,” “smaller
reporting company” and “emerging growth company” in Rule 12b-2 of the Exchange Act.
Large accelerated filer
Non-accelerated filer
Accelerated filer
Smaller reporting company
Emerging growth company
If an emerging growth company, indicate by check mark if the registrant has elected not to use the extended transition period
for complying with any new or revised financial accounting standards provided pursuant to Section 13(a) of the Exchange Act.
Indicate by check mark whether the registrant is a shell company (as defined in Rule 12b-2 of the Exchange
Act). Yes
No
The aggregate market value of the voting and non-voting common equity held by non-affiliates of the registrant as of June 30,
2018 (the last business day of the registrant’s most recently completed second fiscal quarter), was approximately
$4,991,820,388.
The number of shares of common stock outstanding as of February 21, 2019 was 119,566,393.
Portions of the registrant’s Proxy Statement for its 2019 Annual Meeting of Stockholders, to be filed with the Securities and
Exchange Commission no later than 120 days after December 31, 2018, are incorporated by reference in Part III of this Annual
Report on Form 10-K.
Documents Incorporated By Reference
Etsy, Inc.
Table of Contents
Note Regarding Forward-Looking Statements
Part I
Item 1.
Item 1A.
Item 1B.
Item 2.
Item 3.
Item 4.
Item 5.
Item 6.
Item 7.
Item 7A.
Item 8.
Item 9.
Item 9A.
Item 9B.
Item 10.
Item 11.
Item 12.
Business
Risk Factors
Unresolved Staff Comments
Properties
Legal Proceedings
Mine Safety Disclosures
Part II
Market for Registrant's Common Equity, Related Stockholder Matters and Issuer Purchases of
Equity Securities
Selected Consolidated Financial and Other Data
Management's Discussion and Analysis of Financial Condition and Results of Operations
Quantitative and Qualitative Disclosures About Market Risk
Financial Statements and Supplementary Data
Report of Independent Registered Public Accounting Firm
Consolidated Balance Sheets as of December 31, 2018 and 2017
Consolidated Statements of Operations for the years ended December 31, 2018, 2017, and 2016
Consolidated Statements of Comprehensive Income (Loss) for the years ended December 31,
2018, 2017, and 2016
Consolidated Statement of Changes in Stockholders' Equity for the years ended December 31,
2018, 2017, and 2016
Consolidated Statements of Cash Flows for the years ended December 31, 2018, 2017, and 2016
Notes to Consolidated Financial Statements
Changes in and Disagreements with Accountants on Accounting and Financial Disclosure
Controls and Procedures
Other Information
Part III
Directors, Executive Officers and Corporate Governance
Executive Compensation
Security Ownership of Certain Beneficial Owners and Management and Related Stockholder
Matters
Item 13.
Item 14.
Certain Relationships and Related Transactions, and Director Independence
Principal Accounting Fees and Services
Part IV
Item 15.
Item 16.
Exhibits, Financial Statement Schedules
Exhibit Index
Form 10-K Summary
Signatures
Page
1
1
25
47
47
47
47
48
48
50
53
89
90
91
93
94
95
96
97
99
134
134
134
135
135
135
135
135
135
136
136
136
137
138
Unless the context otherwise requires, we use the terms “Etsy,” the “Company,” “we,” “us” and “our” in this Annual Report on
Form 10-K, (“Annual Report”), to refer to Etsy, Inc. and, where appropriate, our consolidated subsidiaries.
See “Management’s Discussion and Analysis of Financial Condition and Results of Operations—Key Operating and Financial
Metrics” for the definitions of the following terms used in this Annual Report: “active buyer,” “active seller,” “Adjusted
EBITDA,” “GMS,” “international GMS,” and “mobile GMS.”
NOTE REGARDING FORWARD-LOOKING STATEMENTS
This Annual Report on Form 10-K contains forward-looking statements within the meaning of the federal securities laws.
Forward-looking statements include information relating to our anticipated international growth, the timing of product launches
and our cloud migration, the impact of our strategy, marketing and product investments, and cloud migration on future GMS
and revenue growth, our economic, social and ecological impact strategy, goals and future plans, expected conversion and visit
growth, the impact of mobile web on conversion rates, efforts to optimize the buyer experience, search and discovery
effectiveness and overall marketplace optimization, and our anticipated expenses and their impact on our future financial
performance. Forward-looking statements include all statements that are not historical facts. In some cases, forward-looking
statements can be identified by terms such as “anticipates,” “believes,” “could,” “estimates,” “expects,” “intends,” “may,”
“plans,” “potential,” “predicts,” “projects,” “seeks,” “should,” “will,” “would,” or similar expressions and the negatives of
those terms.
Forward-looking statements are not guarantees of performance and involve known and unknown risks, uncertainties, and other
factors that may cause our actual results, performance, or achievements to be materially different from any future results,
performance, or achievements expressed or implied by the forward-looking statements. Those risks include those described in
the section titled “Risk Factors” and elsewhere in this Annual Report. Given these uncertainties, you should read this Annual
Report in its entirety and not place undue reliance on any forward-looking statements in this Annual Report.
In addition, statements that “we believe” and similar statements reflect our beliefs and opinions on the relevant subject. These
statements are based upon information available to us as of the date of this Annual Report and, although we believe such
information forms a reasonable basis for such statements, such information may be limited or incomplete, and our statements
should not be read to indicate that we have conducted an exhaustive inquiry into, or review of, all potentially available relevant
information. These statements are inherently uncertain and investors are cautioned not to unduly rely upon these statements.
Moreover, we operate in a competitive and rapidly changing environment. New risks and uncertainties emerge from time to
time and it is not possible for us to predict all risks and uncertainties that could have an impact on the forward-looking
statements made in this Annual Report. In light of these risks, uncertainties, and assumptions, the future events and trends
discussed in this Annual Report may not occur and actual results could differ materially and adversely from those anticipated or
implied in the forward-looking statements.
Forward-looking statements represent our beliefs and assumptions only as of the date of this Annual Report. We disclaim any
obligation to update forward-looking statements.
Item 1. Business.
Overview
PART I.
Etsy is the global two-sided marketplace for unique and creative goods. Our mission is to “Keep Commerce Human,” and
we’re committed to using the power of business and technology to strengthen communities and empower people around the
world. We connect creative entrepreneurs with thoughtful consumers looking for items that are intended to be special, reflect
their sense of style, or represent a meaningful occasion. Etsy was founded in June 2005 in Brooklyn, New York.
Our sellers are the heart and soul of Etsy, and our technology platform allows our sellers to turn their creative passions into
economic opportunity. We have a seller-aligned business model: we make money when our sellers make money. We offer our
sellers a marketplace with millions of buyers along with a range of seller tools and services that are specifically designed to
help our creative entrepreneurs generate more sales and scale their businesses.
We are focused on attracting potential buyers to the Etsy marketplace for “special” purchase occasions throughout the year and
deepening engagement with our existing buyers by inspiring purchases across multiple categories and special occasions. These
special purchase occasions can occur many times throughout the year and include shopping that reflects an individual's unique
style; gifting that demonstrates thought and care; and celebrations that express creativity and fun. Buyers tell us that they come
to Etsy because Etsy sellers offer items that they can’t find anywhere else. In fact, in a 2018 survey of Etsy buyers, 78% of
buyers agreed that Etsy has items that you can’t find anywhere else.
Special purchase occasions happen throughout the year when a buyer is decorating a home, dressing for an event, celebrating a
special moment, or buying a gift for someone special.
1
As of December 31, 2018, our marketplace connected 2.1 million active Etsy sellers to 39.4 million active Etsy buyers. Etsy
buyers and sellers are located all over the world, and our six core geographic markets are the United States, United Kingdom,
Canada, Australia, Germany, and France. We will continue to invest in these markets, as this is where we have our strongest
concentration of both buyers and sellers, and continue to evaluate geographies in which to make strategic investments. There
are currently more than 60 million items for sale across dozens of retail categories on Etsy.com. In 2018, our marketplace
generated $3.9 billion of Gross Merchandise Sales, (“GMS”), of which approximately 55% came from purchases made on
mobile devices. In 2018, our top six retail categories were: homewares and home furnishings, jewelry and personal accessories,
apparel, craft supplies, paper and party supplies, and beauty and personal care. We are a global company and 35% of our 2018
GMS was generated when the Etsy seller or Etsy buyer, or both, were located outside of the United States.
Our revenue is diversified, generated from a mix of marketplace activities and other optional services we provide to Etsy sellers
to help them generate more sales and scale their businesses.
Marketplace revenue is comprised of the fees an Etsy seller pays us for marketplace activities. Marketplace activities include
listing an item for sale, completing transactions between a buyer and a seller, and using Etsy Payments to process payments,
including foreign currency payments. Fees include the 5% transaction fee that an Etsy seller pays for each completed
transaction, inclusive of shipping fees charged, the $0.20 listing fee she pays for each item she lists (for up to four months) on
Etsy.com, and fees for Etsy Payments, our payment processing product. On July 16, 2018, we increased our seller transaction
fee from 3.5% to 5%, and now apply it to the cost of shipping in addition to the cost of the item. The revised fee structure is
intended to support increased investments in the growth and health of the marketplace. Revenue from Etsy Payments, included
in Services revenue prior to 2018, is now included in Marketplace revenue because Etsy Payments is required to be used by
Etsy sellers in the countries where it is available.
Services revenue, formerly called Seller Services revenue, is comprised of the fees an Etsy seller pays us for our optional
services (“Services”). Services include Promoted Listings, our on-site advertising service that allows sellers to pay for
prominent placement of their listings in search results; Etsy Shipping Labels, which allows sellers in the United States, Canada,
United Kingdom, and Australia to purchase discounted shipping labels; Pattern, a service that allows sellers to build custom
websites; and Etsy Plus, a subscription offering that provides sellers with enhanced tools and credits for use on our platform.
We also generate additional revenue through our commercial partnerships, which is classified as other revenue.
2
Our Opportunity
We believe that the nature of commerce is continuing to evolve: more people are choosing to purchase goods online and many
consumers are looking for unique items as an alternative to mass produced goods. According to estimates by Euromonitor, a
market research company, worldwide retail ecommerce will generate double-digit growth each year through 2022, and
worldwide retail ecommerce sales will reach $3 trillion by the end of 2022. (Source: Euromonitor — Worldwide Internet
Retailing.) We estimate that, in 2018, the online market size across all relevant retail categories within our six core geographic
markets; United States, United Kingdom, Canada, Australia, Germany, and France, represents a $249 billion market
opportunity, and a $1.7 trillion market opportunity when offline is included.
Our Platform
Etsy leverages technology to connect people around the world through commerce. Our platform includes our marketplace, our
seller tools and services, our passionate and engaged sellers and buyers, and our technology. Our commitment to transparency
and integrity underpins our platform and establishes trust within our marketplace and our community.
Key Components of Our Platform
Our Marketplace
Our marketplace, Etsy.com, is where thoughtful buyers come to discover a broad selection of unique goods that are hard to find
elsewhere. In a world of increasing automation and commoditization, Etsy celebrates creativity and human interaction.
We believe our marketplace is characterized by several unique qualities, including:
• Unique Products: Our marketplace boasts a large assortment of handmade, customized, personalized, vintage, and craft
supply products from all of the world. There are currently more than 60 million items listed on our marketplace. We intend
to continue to improve the customer experience by investing in our search and discovery capabilities to help buyers
efficiently find the special items they are looking for and deliver a brand promise around shipping to align with our buyers’
expectations of when they can expect to receive our unique items.
• Global Reach: Etsy’s six core geographic markets are the United States, United Kingdom, Canada, Australia, Germany,
and France, and there are people using our platform to buy and sell in nearly every country around the world. Our platform
makes it easy for Etsy buyers and Etsy sellers to interact across borders even if they do not speak the same language and
wish to transact in different currencies. We use innovative machine translation technology to translate listings, reviews,
Promoted Listings, and conversations between Etsy buyers and Etsy sellers. Our payments platform allows Etsy sellers to
offer Etsy buyers a wide range of payment options. In 2018, 37% of Etsy sellers were located outside the United States,
and 35% of our GMS was generated between an Etsy seller, Etsy buyer, or both, located outside of the United States.
• Organic Traffic Base: We’ve built a loyal, global base of buyers on the platform without significant investment in
acquisition marketing until 2013, eight years after being founded. Unlike many other ecommerce companies, the vast
majority of visits to Etsy.com came through organic channels. In fact, approximately, 85% of visits in 2018 were from
organic sources, including a large portion from buyers visiting Etsy.com directly as well as from non-paid channels such as
search, social, email, and push notifications.
• Connection Between Buyers and Sellers: We believe that human connection is central to buyer engagement. On Etsy, we
emphasize that the items listed for sale are brought to life by real people. Additionally, buyers are able to connect directly
with sellers in order to ask questions and personalize or customize items to their specifications. We also encourage buyers
3
and sellers to connect in a variety of other ways, such as through sharing reviews on social media or connecting off-line
through the Etsy Local feature on our mobile app. We believe that meaningful interactions with Etsy sellers differentiates
us from other e-commerce platforms, drives buyer engagement, and keeps our buyers coming back.
• Connected Experience Across all Devices: We want to engage Etsy buyers wherever they are and to provide an enjoyable
and accessible shopping experience no matter how they come to Etsy. Our mobile website and our “Buy on Etsy” mobile
app for Etsy buyers include search and discovery, curation, personalization and social shopping features. Our Etsy.com iOS
and Android mobile apps have been downloaded approximately 56 million times as of December 31, 2018. We offer a
connected experience through each channel, desktop, mobile web, and mobile app, to help ensure that no matter what
device our buyers use they will have the best possible experience. For the year ended December 31, 2018 approximately
55% of our GMS was generated on a mobile device. This is an increase compared with 2017, during which 51% of our
GMS was generated on a mobile device. We are focused on increasing conversion rates in general; however, we are
particularly focused on mobile web, which continued to be the largest driver of both overall visits growth and mobile GMS
growth. Mobile web conversion rate is about half the conversion rate on desktop and the conversion rate on our mobile
Buy on Etsy app is about 1.2x the desktop conversion rate. Therefore, if mobile web visits continue to grow as a
percentage of overall visits, it could be a headwind to future conversion rate gains.
• Buyer Intent; People Come to Etsy to Browse and be Inspired: Our platform is designed to provide a personalized search
experience to Etsy buyers, adjusting in real time based on transaction data and previous browsing history. A large portion
of our buyers come to Etsy not in search of a specific item, but to browse and be inspired. We are continuing to build more
sophisticated algorithms that allow us to deliver more personalized results to our buyers, utilizing browse and transaction
data to surface items they didn’t know they wanted. In 2018, we launched a number of products to enhance search,
including adding recommendations to item landing pages and incorporating more attributes to our search algorithm to
improve search ranking. All of this helps bring fun to the discovery and shopping experience. We believe we have
significant opportunities to further enhance our search and discovery capabilities and plan to leverage our machine learning
technology to deliver an even more personalized shopping experience. In addition, our full migration to Google Cloud by
the beginning of 2020 is expected to further improve our search and discovery effectiveness.
Etsy sellers are required to pay a fixed listing fee of $0.20 for each item listed on Etsy.com for a period of four months or, if
earlier, until a sale occurs. Once a sale is consummated, sellers pay variable transaction fees and Etsy Payments fees.
On July 16, 2018, we increased our seller transaction fee from 3.5% to 5%, and now apply it to the cost of shipping in addition
to the cost of the item. Etsy Payments processing fees vary between 3% to 4.5% of an item’s total sale price, including
shipping, plus a flat fee per order, depending on the country in which a seller’s bank account is located. When a foreign
currency payment is processed, an additional 2.5% to 5% fee is applied. As of December 31, 2018, Etsy Payments was
available in 36 countries and 12 currencies and nearly all sellers in countries where Etsy Payments is available are required to
use the service. In fact, 86% of total GMS was processed through Etsy Payments in 2018, up from 85% in 2017. Our ability to
expand Etsy Payments into additional countries is dependent upon the third-party providers we use to support this service.
Our Seller Tools and Services
Seller tools and services help Etsy sellers generate more sales and scale their businesses. In addition to driving incremental
revenue streams to Etsy, these offerings play a key role in supporting sellers’ businesses and driving sales. Our optional paid
services are (in order of 2018 revenue contribution): Promoted Listings, Etsy Shipping Labels, Pattern, and subscription
packages. Services revenue grew 42.1%, and represented 26.3% of our total revenue, up from 25.4% in 2017.
• Promoted Listings: Promoted Listings enable Etsy sellers to pay a cost-per-click based fee to feature and promote their
goods in our marketplace in search results generated by Etsy buyers. This service allows Etsy sellers to target Etsy buyers
who are specifically searching for goods similar to those she offers for sale. During 2018, 15.1% of active sellers used
Promoted Listings up from 15.0% in 2017. In 2018, we enhanced Promoted Listings by expanding inventory across all
devices and adding context specific search ranking to improve ad relevance and higher click-through rates, which both led
to accelerated year-over-year revenue growth for this service. We optimized our sellers’ budgets and generated a positive
return on their spend in 2018. We aim for sellers to be ROI positive and often utilize less than their allocated budget.
• Etsy Shipping Labels: This service allows sellers in the United States, Canada, United Kingdom, and Australia to purchase
discounted United States Postal Service, FedEx, Canada Post, Royal Mail, and DAI Post shipping labels through our
platform. The ability to print the shipping labels at home reduces the cost and time it takes Etsy sellers to ship items to Etsy
buyers, reduces the chance for administrative error through features such as auto population of shipping addresses, and
automatically provides tracking information when available and shipping notifications to buyers. During 2018, 24.7% of
active sellers in regions where Etsy Shipping Labels is offered used this product, down from 28.1% in 2017. The reduction
in percentage of active sellers using Etsy Shipping Labels was driven by the expansion of the service in the United
4
Kingdom and Australia in late 2018 where adoption could take some time to develop. Despite this, year-over-year revenue
growth for this service accelerated compared to 2017 driven by GMS growth.
• Pattern: With Pattern, Etsy sellers can create their own custom websites with unique domain names within minutes.
Pattern imports listings and content from Etsy shops, syncs inventory and orders, and utilizes our Etsy Payments and Etsy
Shipping Label services. In 2018, we began allowing sellers to sell items or services on their Pattern website that don’t
follow the handmade and vintage guidelines within our Etsy.com marketplace. Sellers may use Pattern for free for the first
30 days, then they are charged $15 per month, plus payment processing fees and Etsy Shipping Label fees, if they choose
to use this service.
•
Subscription Packages: Our subscription packages were launched in July 2018 as a way for us to bundle and simplify our
offerings for sellers. The Etsy Plus subscription package, which allows sellers to pay for enhanced tools and credits to use
on the Etsy.com platform, is $10 per month and features enhanced tools such as advanced shop customization options,
targeted restock notifications, discounts on branded packaging and promotional materials, and free or discounted custom
web addresses. Additionally, Etsy Plus includes $5 of Promoted Listing credits and 15 free listing credits per month.
We believe we can grow our optional paid services in three ways: expand the utility of existing services, expand the geographic
reach of existing services, and launch new services offerings. In addition to our paid services, we provide a wide range of tools
and educational resources to give Etsy sellers the support they need to manage the administrative side of their businesses.
According to our bi-annual seller survey, most recently conducted in 2018, for every hour that an Etsy seller spends making her
products, she spends almost another hour doing business-related tasks, including inventory management, marketing, shipping,
customer service, and accounting. Our tools and educational resources help manage these administrative burdens.
•
Seller Tools: We offer a variety of free tools to Etsy sellers, including marketing tools such as our Google Shopping tool.
Google Shopping gives our sellers a complementary way to target buyers outside of the Etsy marketplace at key moments
when they are searching for items on Google. Sellers set a daily budget and a target country or a number of geographies
through their Shop Manager dashboard and we optimize their budget and target a return on their spend. Our Shop Manager
dashboard, which we launched in 2017, serves as a centralized hub for Etsy sellers to track orders, manage inventory, view
metrics and statistics, and have conversations with their customers across all of their Etsy shops. In 2018, we added a
single, easy-to-use interface that streamlines sellers’ bills and payments accounts. Other marketing tools include Targeted
Offers, our sales and promotions tool, and our social media tool, which help sellers with their marketing needs and allows
them to stand out on and off the Etsy platform. Also, through a partnership with Intuit, sellers in the United States and the
United Kingdom can simplify their accounting and bookkeeping.
• Education: We provide extensive educational resources to teach Etsy sellers how to start, manage, and scale their
businesses on our platform, including blog posts, video tutorials, the Etsy Seller Handbook (available on Etsy.com),
Etsy.com online forums, and insights from Etsy.com support teams. In addition to our resources, Etsy sellers connect
through self-organized Etsy Teams to build personal relationships with other Etsy sellers, collaborate, educate, and support
each other as they build their independent creative businesses. Currently, over 16,000 Etsy Teams have formed around the
world.
5
Etsy’s focus on supporting our sellers in starting, managing, and scaling their businesses strengthens our marketplace and
positions it for continued growth. When our sellers succeed, Etsy succeeds.
How an Etsy Seller Spends Her Time
2018 seller survey
Key 2018 Investments
Marketing: In July 2018, we revised our fee structure which enabled us to invest more in marketing while maintaining our
return on investment. We increased digital marketing spend by 58.5% in 2018 to $112.2 million, and continued to optimize our
marketing attribution model. We experimented with offline marketing and television advertising tests in the second half of
2018, and conducted pre- and post-brand awareness research to supplement our quantitative data.
Google Cloud: We made progress and are on track with our migration to Google Cloud, which we expect to complete by the
beginning of 2020. Among other anticipated benefits discussed below, we believe the migration will enhance our overall
infrastructure by providing faster processing speed, improved page load time and more nimble server capacity on an as needed
basis.
Search: We continued investing in our machine learning capabilities in order to help buyers find the right selection of products,
from the over 60 million items available in our marketplace. In 2018, we improved search relevance and began localizing
search results by using context specific ranking.
Customer Support: Our partnership with Zendesk supported improvements to our customer experience and lower costs. We
introduced live chat for our sellers, and dedicated 24x7 phone support for both buyers and sellers.
Shipping: We made progress evolving our search algorithms in order to more prominently promote items that have
competitively priced shipping, introduced shipping price notifications for sellers, and launched the ability for sellers to display
an expected delivery date. Also, in 2018, we expanded our Etsy Shipping Labels offering to sellers in the United Kingdom and
Australia.
6
Our Passionate and Engaged Sellers and Buyers
Etsy Sellers
Our sellers are the backbone of Etsy’s business and what matters most to them is our community of over 39 million buyers. In
order to continue to support our sellers’ growth, we are focused on making Etsy the best place to start and run a creative
business. We serve those creative entrepreneurs around the world who choose to pursue their passions, offering them a global
base of millions of buyers and a cohesive suite of tools and services to help them run their business and drive sales. Etsy sellers
range from hobbyists to professional merchants, and have a broad range of personal and professional goals. Our 2018 seller
survey found that 60% of Etsy sellers are multi-channel sellers and on average Etsy is their primary source of sales.
According to the 2018 seller survey:
•
•
•
•
•
87% identify as women;
75% consider their Etsy shop to be a business;
97% run their shops from their homes;
82% aspire to grow their sales in the future; and
64% started their Etsy shop as a way to supplement income.
Our 2018 seller survey found that 32% of Etsy sellers were pursuing their creative business as their sole occupation. In addition
to our 2018 seller survey, we conducted a separate survey of our top decile sellers in 2017. Key findings included that 95% of
our top decile sellers intended to remain with Etsy for the next 12 months.
Etsy Sellers
Etsy Buyers
Etsy supports a community of over 39 million buyers, who value self expression, unique items, and buying directly from
creative entrepreneurs. In a 2018 survey of Etsy.com buyers, 78% of buyers agreed that Etsy offers products they cannot find
anywhere else. Etsy buyers can enjoy a personalized shopping experience and build relationships through direct interactions
with Etsy sellers. Etsy buyers can also purchase customized items and craft supplies from Etsy sellers. By shopping on
Etsy.com, Etsy buyers are supporting creative entrepreneurs in their local communities and around the world.
We are focused on driving more new buyers to the platform and encouraging existing buyers to purchase more often. New
buyers are considered unique buyers that have never made a purchase on Etsy. During 2018, we had 17.5 million new buyers,
which represented approximately 18% of overall GMS. GMS from new buyers was up 16% year-over-year. GMS from existing
buyers grew 23% year-over-year in 2018 and represented approximately 82% of overall GMS, an increase compared to last
year.
7
Repeat buyers represent shoppers who have ever bought on Etsy, regardless of when their first purchase day occurred. We
believe repeat purchases demonstrate the loyalty of Etsy buyers. In 2018, approximately 40.1% of our active buyers made
purchases on two or more days in the previous 12 months, a slight increase compared to last year. Within that category, we are
particularly focused on increasing our number of habitual buyers, or buyers who have spent $200 or more and made purchases
on six or more days in the previous 12 months. As of December 31, 2018, habitual buyers grew to 2.0 million, an increase of
21.7% compared to 2017. This is faster than overall active buyer growth, indicating our efforts to convert buyers into more
loyal shoppers on the platform are seeing signs of success.
Active Buyers by Purchase Type
8
Unlike many other ecommerce companies, the vast majority of visits come to Etsy from organic channels. In 2018, 85% of
visits came to Etsy.com from an organic source, including a large portion from buyers visiting Etsy.com directly as well as from
non-paid channels such as search, social, email, and push notifications. Paid visits are attributed to visits generated from our
marketing efforts. Over the last five years, paid visits have increased as a percentage of total visits as a result of our increased
investment in marketing. A visit represents activity from a unique browser or mobile app. A visit ends after 30 minutes of
inactivity.
Visits Contribution by Source Type
9
Etsy Seller & Buyer Retention
Our active sellers and active buyers typically remain so for multiple years. For example, 33.1% of active sellers and 37.5% of
active buyers as of December 31, 2015 continued to be active sellers and active buyers through their fourth year on the
platform and 31.8% of active sellers and 38.7% of active buyers as of December 31, 2014 continued to be active sellers and
active buyers through their fourth year on the platform. In addition, as of December 31, 2018, 19.6% of active sellers have been
selling on Etsy for more than four years. Likewise, as of December 31, 2018, 24.5% of active buyers have been Etsy buyers for
more than four years.
AVG GMS
2011
$817
$2,241
$3,314
$4,299
AVG GMS
2011
$103
$177
$186
$195
PER SELLER
2012
$1,079
$2,598
$3,935
$4,557
PER BUYER
2013
$1,260
$3,110
$4,190
$4,620
2014
$1,465
$3,325
$4,228
$4,615
2012
2013
2014
$96
$96
$99
$163
$173
$181
$161
$168
$174
$157
$164
$169
2015
$1,558
$3,296
$4,062
$4,939
2015
$101
$158
$163
$180
Cohorts of 2015, 2014, 2013, 2012, and 2011 Active Sellers and Active Buyers
See “Management’s Discussion and Analysis of Financial Condition and Results of Operations—Key Factors Affecting Our
Performance—Growth and Retention of Active Buyers and Active Sellers” for more information.
10
Our Technology
Our widely respected engineering team has built a sophisticated platform that enables millions of Etsy sellers and Etsy buyers
to smoothly transact across borders, languages, and devices. We collect and analyze large volumes of data to enhance the
performance of our platform. For example, on average, we capture roughly one billion user-generated events every day to
produce personalized recommendations, improve our search experience and test features on our website.
Our use of machine learning algorithms creates an engaging shopping experience and also helps Etsy sellers and Etsy buyers
connect across our platform. We apply proprietary machine learning to the search and discovery processes, enabling shoppers
to more easily browse, filter, and buy that perfect item, even when they may not have something specific in mind.
Machine translation and machine learning also play an important role in making it easy for Etsy sellers and Etsy buyers to
connect even if they don’t speak the same language. We translate listings within our Etsy.com market into 10 languages which
we believe significantly increases the inventory available to non-English speaking Etsy buyers and gives Etsy sellers access to
a truly global audience.
Our technology infrastructure allows us to scale our efforts across the platform. In late 2017, we announced our migration to
Google Cloud, which we believe will enable us to focus on growing our core Etsy.com marketplace, prioritize the buyer and
seller experience, improve our search and discovery effectiveness, and increase the pace of launching new features. We expect
the migration will result in increased engineering efficiency shifting the focus from maintaining on-premise systems to product
engineering work that is more strategic. We also believe the migration will enhance our overall infrastructure by providing
faster processing speed, improved page load time, and more nimble fulfillment to capacity on an as needed basis. In the third
quarter of 2018, we achieved a significant milestone by successfully migrating our website and mobile apps to Google Cloud.
We expect to complete the migration by the beginning of 2020.
Commitment to Integrity and Transparency
Members of our community rely on us to maintain a trusted marketplace. Our policies are designed to encourage transparency
and clearly outline the rights and responsibilities of Etsy sellers and Etsy buyers participating on our platform. Most
fundamentally, we require that goods listed in our marketplace be handmade or unique and assembled with production partners,
vintage, or craft supplies.
Transparency within our community helps to support our trustworthiness. For example, we publish an annual report that details
progress toward our ideals and shares our hopes for the years to come. We also annually report statistics regarding shops that do
not meet our guidelines or which list items that are alleged to infringe third party rights. In 2018, we closed 3,609 Etsy.com
shops that were subject to repeat notices of intellectual property infringement and closed 109,473 Etsy.com accounts for non-IP
policy violations.
Additionally, we are focused on enhancing customer service for Etsy sellers and Etsy buyers, which we believe bolsters the
trustworthiness of our marketplace. In 2018, we migrated our legacy support platform to a new third-party customer service
platform, Zendesk, to improve our customer experience. This migration enabled us to introduce live chat for our sellers, and
dedicated 24x7 phone support for both buyers and sellers.
We strive to give the Etsy buyer comfort that she is purchasing goods from a shop that adheres to certain principles. Etsy
buyers have a high degree of insight into Etsy sellers’ business practices. Our policies ask Etsy sellers to be transparent about
themselves, their businesses and the goods they sell. We also have dedicated teams and sophisticated tools to help enforce our
policies. For example, our Integrity team uses a combination of machine learning, automated systems, and community-
generated flags to review items and shops that may violate our policies. Our Trust and Safety team helps to prevent and detect
fraud through human review and automated tools and algorithms. We also recognize that sometimes transactions don’t go as
planned. When that happens, our online Case System provides a way for Etsy sellers and Etsy buyers to communicate with
each other to resolve disputes. In 2018, 0.3% of orders resulted in a case. We also establish trust by emphasizing the person
behind every transaction. We deepen connections between Etsy sellers and Etsy buyers through our direct communication tools,
seller stories on our website and apps, and in-person events, highlighting personal relationships as a key part of the Etsy
experience. For example, Etsy sellers are encouraged to share their stories to reach Etsy buyers on our platform and on social
media. The trustworthiness of our marketplace and the connections among people in our community are cornerstones of our
business.
11
Our Strategy
Since mid-2017, we have focused our strategy on growing the Etsy.com marketplace in our six core geographies and executing
upon four key initiatives to make Etsy a better place to shop and sell. These initiatives involved making investments and
improvements in search and discovery, trust and reliability, marketing capabilities, and seller tools and services. Successfully
delivering on these initiatives has resulted in significant improvements to and growth of our marketplace.
In order to deliver sustainable long-term growth, we are building upon this strategy to incorporate additional elements that we
believe, over time, will make Etsy a best-in-class marketplace. Our investments in product, marketing, and talent will be
focused on capitalizing on what we believe are our core competitive advantages; or what we think of as our “Right to Win.”
The foundation of Etsy’s competitive advantage is our collection of unique items, which, we believe, when combined with best-
in-class search and discovery, human connections, and a trusted brand, will enable us to continue to stand out among other
ecommerce platforms and marketplaces. We will lean into the humanity and vibrancy of our market, increasing the connection
between buyers and sellers, establishing strong trust signals for product quality and customer experience, removing barriers to
purchase, and giving sellers more ways to generate sales and scale their businesses.
Ultimately, the goal of our long-term strategy is to drive more new buyers to the website, give existing buyers reasons to come
back more often, encourage buyers to spend more per order, and fuel success for our sellers, which we believe will drive
growth. Etsy has a significant number of habitual buyers (Etsy buyers that have purchased $200 or more on Etsy.com and have
made purchases on six or more purchase days in the last 12 months) and we believe we have the ability to attract many more
buyers like them to Etsy and convert them into habitual buyers. For example, we believe we can deepen engagement with our
existing buyers by inspiring purchases in additional categories and on additional occasions. We also plan to continue supporting
our sellers by focusing on enhancing the seller tools and services that will drive buyer demand. We believe that we are just
getting started improving this virtuous cycle of growth.
Further expanding on these two primary components of our long-term strategy we will:
1. Focus on the Etsy marketplace in our six core geographies:
The first component and foundation of our growth strategy remains to focus on the Etsy marketplace in our six core
geographies (the United States, United Kingdom, Canada, Australia, Germany, and France). These six locations are where we
have our largest concentrations of buyers and sellers and, consequently, where we believe we have the most significant
opportunities for growth. We are building local marketplaces globally, deepening local Etsy communities around the world,
each with its own ecosystem of Etsy sellers and Etsy buyers. A barometer of our local market vibrancy is the performance of
our international domestic trade route, by which we mean GMS generated between a non-U.S. buyer and a non-U.S. seller both
in the same country. GMS from this trade route grew approximately 36% in 2018 compared with 2017, making it the fastest
growing category of international GMS.
In 2018, we announced a referral agreement with DaWanda, a privately held marketplace for gifts and handmade goods based
in Germany, encouraging its community of buyers and sellers to migrate to the Etsy platform. This agreement brought
meaningful new breadth and depth of inventory to Etsy, helping to make Germany our second largest international market
(after the United Kingdom) by domestic activity. While we focus on our six core markets, we will also continue to evaluate
additional geographies in which to make strategic investments. For example, we have made initial investments to explore
growth opportunities in India.
12
We see significant opportunity to deliver a more localized shopping experience to non-U.S. buyers in the future, including
investments in the elevation of local products and sellers in search, improving non-English search, and more local specific
marketing and campaigns.
2. Build a sustainable competitive advantage:
As described above, the second component of our go-forward strategy is predicated around building a sustainable competitive
advantage centered on these four key elements;
Our Collection of Unique Items: The foundation of Etsy’s competitive advantage is our collection of unique items. Our
marketplace features over 60 million items listed across dozens of retail categories, and boasts a large assortment of unique,
handmade, vintage, and craft supply products from all over the world. This unique inventory is the result of having created a
community that attracts, supports, and retains some of the world’s most talented makers. In a 2018 survey of Etsy buyers, 78%
agreed that Etsy has items that you can’t find anywhere else - that something “special in a sea of sameness.” We believe our
marketplace is the only place where you can find the depth and breadth of one-of-a-kind items, including millions that can be
customized and personalized. The breadth and depth of the special items listed in our marketplace is the linchpin of our long-
term strategy. However, the unique nature of these items requires that we invest in the other three parts of our long-term
strategy: search and discovery, human connections, and our trusted brand in order deliver a best-in-class marketplace
experience.
Best-in-class search and discovery: We are focused on continuing to develop a search and discovery experience that unlocks
the value of the unique items in our marketplace. With millions of items listed on Etsy.com that don’t map to a catalog or a
stock keeping unit (“SKU”), our challenge is delivering world-class search and discovery technology that surfaces the right
product to the right buyer at the right time in order to drive sales and buyer satisfaction. We are utilizing artificial intelligence
and machine learning to help personalize the search experience and enable buyers to more easily browse, filter and find the
item they desire.
In 2018, we significantly enhanced the search and discovery experience in our marketplace. We leveraged Context Specific
Search Ranking (“CSR”) by adding even more attributes such as location and shipping prices into our ranking algorithm to
deliver more relevant results. We also began to leverage user generated content, introduced a new discovery feed and discovery
badges to inspire buyers to explore more products and expand their search beyond their original intent and optimized landing
pages by adding more recommendations and notifications, including alerts on listing cards when scarce items appear in other
people’s carts.
We will also work to ensure that buyers have more help discovering the perfect item for them. Since our marketplace is built on
over two million individual but largely unknown brands, we see significant opportunity to improve how we signal high quality
items and deliver a great customer experience to buyers. We believe that by personalizing the Etsy search and discovery
experience we can deepen buyer engagement and drive greater visit and purchase frequency. We expect that our transition to
cloud-based technology and additional future investments in machine learning and artificial intelligence, among other factors,
will enable us to deliver a best-in-class search experience.
The power of human connections: Our mission to “Keep Commerce Human” is a vital part of our strategy.We will continue to
emphasize the role that humans play in every aspect of our marketplace. What makes Etsy special isn’t just the items in our
marketplace; it’s also the stories of how those items were brought to life by the hands of real people. Our buyer experience
highlights the story behind each item, and also allows buyers to create their own stories by working with a seller to personalize
or customize items to their exact specifications. In fact, data shows that when a buyer reaches out to a seller with a question
they are significantly more likely to purchase a listing from that seller, and conversion rate goes up as response time gets
shorter.
In 2018, we began to streamline the purchase flow for orders that are personalized or customized and made it easier for buyers
to connect with sellers to design high quality items on the platform. We plan to invest more to make sure that buyers and sellers
know that Etsy is the destination for personalized items, and it is our goal to make buying and selling such items intuitive and
easy.
We believe that fostering and elevating the quality of these interactions will also enable us to drive buyer engagement, loyalty,
and purchase frequency, and continue to differentiate Etsy from other ecommerce platforms. Shifting over time from our
current item-first framework to one that highlights shops and sellers is a way to elevate the role of our makers and their creative
processes. Our goal is to bring human connections to life through improvements in member support, seller forums
13
management, our brand and marketing campaigns, and other ways that we promote our marketplace. Lastly, we plan to deepen
loyalty by creating opportunities for buyers to experience Etsy across categories and occasions.
A brand you can trust: We will continue to focus on being a brand that inspires trust in our customers across the buyer journey
-- when they search, purchase, anticipate and receive their special items, and all the steps in between. Since our sellers have
relatively unknown brands and unbranded items, we aim to ensure that the Etsy brand is recognized and valued for providing
an excellent end-to-end experience. There are two key elements to being a trusted brand: standing for something that customers
understand and rely on, and delivering a purchasing experience that feels safe and supportive. Our goal is to bolster trust in the
Etsy brand, Etsy sellers, the items available in our marketplace, and in the overall Etsy experience. In 2018, we improved buyer
confidence with the launch of several new products, including a new iteration of guest checkout on mobile web, an alternative
payment option common to German buyers, and an improved purchase path for items that are personalized or customized. We
also made significant progress in customer support by partnering with Zendesk, a customer service software company. Our
Zendesk partnership has enabled us to launch live chat and dedicated 24x7 phone support, which has improved the support
experience for our buyers and sellers.
We plan to continue to optimize the core buyer shopping experience - to make it less fragmented and to remove friction. This
will involve making sure that buyers can find what they want, can easily keep exploring for inspiration, and have the right
information to make a purchase decision at every step along the way. We see significant room for additional improvements to
our landing pages, our ability to surface recommendations so buyers do not hit dead ends, and to make sure we are surfacing
relevant purchase information. By focusing on shipping enhancements and transparent delivery and returns we can help buyers
better understand what to expect across Etsy.
In addition, we plan to evolve our marketing strategy and investments to reinforce our core brand promise in the hearts and
minds of buyers. We believe that we can continue to grow our acquisition marketing efforts. We expect to add new marketing
channels, optimize our spend in these channels and work with sellers to help them better understand the impact of marketing on
their business (for example, with improved seller analytics tools), and to promote their shops to Etsy buyers.
Our Mission, Guiding Principles, and Team
Mission
Etsy’s mission to “Keep Commerce Human” is rooted in our belief that, although automation and commoditization are parts of
modern life, human creativity cannot be automated and human connection cannot be commoditized. This is what makes Etsy
and our marketplace distinct from mass retailers. Our mission guides our daily decisions, sets the path for our long-term
success and reinforces our commitment to make a positive social, economic, and environmental impact.
Guiding Principles
Our guiding principles define who we strive to be, inform our business decisions, and enable us to achieve our mission. Our
guiding principles are:
We commit to our craft. Our work has the power to change lives. That’s why we strive to continuously learn and excel at what
we do.
We minimize waste. Time, resources, and energy are precious, so we focus only on what will have the greatest impact.
We embrace differences. Diverse teams are stronger, and inclusive cultures are more resilient. When we seek out different
perspectives, we make better decisions and build better products.
We dig deeper. The best solutions to meaningful challenges are rarely easy or obvious. We stay curious, balance our intuition
with insights, and decide with confidence.
We lead with optimism. We believe in our mission, and we believe in each other. We see the world as it is, set ambitious goals,
and inspire one another with generosity of spirit. Together, we reimagine what’s possible.
14
Our Team
We pride ourselves on our action-oriented, values-based, and purpose-driven work culture. Etsy’s employees work hard to
bring innovative ideas and energy every day to strengthen the experience for sellers and buyers on Etsy.com. As of
December 31, 2018, we had 874 employees worldwide, with 545 employees located in our headquarters in Brooklyn, New
York. Of those employees, we had 318 in engineering, 121 in product, 162 in member operations, 112 in marketing, and 161 in
facilities, IT, and other corporate teams.
We focus on maximizing our employees’ engagement, and their professional and personal well-being. In July 2018, Etsy
conducted an engagement survey of all global employees and seventy percent of respondents reported favorable employee
engagement. We believe employee engagement comes from fulfilling work focused on serving the needs of our sellers and
buyers and from ample personal and professional growth opportunities. We use the results of our engagement survey guide the
development of more dynamic programs that build knowledge and skills and build connectedness between employees.
We also offer our employees paid time off to volunteer so that they can support the causes and organizations they are passionate
about. In 2016, we introduced a 26-week gender-blind parental leave policy that is available to all Etsy employees globally.
Through this policy we aim to support and enable parents to play equal roles in building successful companies and nurturing
their families.
15
Our Impact Strategy and Progress
We believe that consumers are demanding more of the businesses they support and that the companies best positioned to succeed will build win-win solutions that are good
for people, the planet, and profit. We are committed to growing sustainably by aligning our mission, guiding principles, and business strategy.
We have developed an impact strategy that reflects the positive economic, social, and environmental impact we want to have on the world while advancing and
complementing our business strategy. Since announcing our impact strategy in 2017, we have updated some of our goals to be more specific, measurable, and time bound.
We expect to continue to evolve our impact strategy in the future as our impact work matures. We are pleased to share our progress as we execute on this strategy, and we
will continue to report our results transparently as it relates to our impact goals.
Economic Impact: Make creative entrepreneurship a path to economic security and personal empowerment
2018 GOALS
2018 PROGRESS
2019 GOALS
Ensure the economic opportunities
Etsy creates meaningfully benefit a
broad swath of our seller community
Commissioned Etsy’ s first economic impact study with ECONorthwest, an independent economic
consulting firm, to explore the ways Etsy sellers in the United States contribute to the national
economic landscape. We found that in 2018, Etsy sellers:
- Contributed $5.37 billion to the U.S. economy, more than double their direct business sales;
- Created 1.52 million jobs in the independent worker economy, enough jobs to employ the
entire city of San Antonio;
- Generated more than $1.76 billion in income; and,
- Produced $3 billion in additional economic value by harnessing their creativity and bringing
unique products to market.
Double U.S. Etsy sellers’ economic output by
2023
Foster economic security and
personal empowerment for creative
entrepreneurs through charitable and
in-kind contributions
Invested $280K in programs and initiatives that enable creative entrepreneurship, and support
Etsy sellers on their paths to economic security and personal empowerment.
—
Collectively, Etsy employees donated over 2,700 hours of volunteer time in their communities
through Etsy’ s Volunteer Time Off program.
Advance public policies that increase
economic security and reduce
administrative burdens for creative
entrepreneurs
Continued to prioritize seller issues, including tax burdens, financial security and championing
micro-business more broadly in our key markets.
—
Focused on policy solutions that help to grow the creative economy, advocating for net neutrality
and internet sales tax policy. Etsy sellers generated over 140,000 messages to policymakers on
these issues.
Invest in social programs that foster economic
security and personal empowerment for our
stakeholders
Advance public policies that increase
economic security and reduce administrative
burdens for creative entrepreneurs
16
Social Impact: Enable equitable access to the opportunities that we create
2018 GOALS
2018 PROGRESS
2019 GOALS
Meaningfully increase representation
of underrepresented groups and
ensure equity in Etsy’ s workforce
Increased our targeted recruiting efforts, created hiring guidelines to ensure that all candidates
are evaluated fairly and with objective criteria, and implemented a more formal company-wide
performance management process to support consistent and fair evaluations. As a result, female
engineers now make up 33.2% of our engineering workforce at Etsy, up 4% from the prior year.
—
Commissioned a pay equity study using a third party consulting firm which revealed no influence
of age, race, or gender in Etsy’ s pay practices.
—
Ramped up our targeted recruitment efforts by focusing on growing our employer brand
awareness and maximizing our presence at industry conferences and events.
—
Focused on growing our strategic and data-driven recruiting efforts, launching employee
mentorship and sponsorship programs, tracking our diversity & inclusion efforts through
recruiting, hiring, survey, and exit interview data.
Approximately double the percentage of Black
and Latinx employees in Etsy’ s workforce by
2023
Build a diverse, equitable, and
sustainable supply chain to support
our operations and bring value to both
Etsy and our vendors
Updated Etsy’ s supplier code of conduct to highlight the importance of progressive social,
environmental, and economic business practices.
—
Incorporated priority questions into our vendor compliance screening tool in order to develop a
comprehensive baseline of our supply chain impact.
Build a diverse, equitable, and sustainable
supply chain to support our operations and
bring value to both Etsy and our vendors
Increase the presence of
underrepresented populations within
the Etsy seller community
Undertook research to understand and address barriers and activate opportunities for
underrepresented populations within the Etsy seller community.
—
In 2019, we plan to continue investing in this stream of work, embedding our insights into our
product, expanding to focus on both our buyers and our sellers, and building an inviting and
inclusive user experience.
Make Etsy a more inclusive and welcoming
marketplace for people from underrepresented
backgrounds
17
Ecological Impact: Build long-term resilience by eliminating our carbon impacts and fostering responsible
resource use
2018 GOALS
2018 PROGRESS
2019 GOALS
Utilize and source energy responsibly
so that we can power our operations
with 100% renewable electricity by
2020 and reduce the intensity of our
energy use by 25% by 2025
Procured 58% of our electricity from renewable sources, up from 30% in 2017.
—
Entered into a virtual power purchase agreement for solar energy to help us meet our goal of
powering our operations with 100% renewable electricity by 2020.
—
Began transition to cloud computing to help reduce our energy consumption and selected Google
Cloud Platform, a partner that shares our commitment to 100% renewable electricity.
—
In 2018, our colocated data centers accounted for 68% of total energy consumed, or 7,330 MWh.
Due to data availability challenges, our current energy footprint is not inclusive of cloud
computing, but does include our colocated data centers. In 2019, we will continue to explore how
to accurately quantify our cloud energy footprint, and how to activate levers of change to drive
further efficiencies in computing.
—
Achieved a 25% reduction in energy intensity (kWh per square foot) across our office operations
based on a 2016 baseline, and an associated 15% reduction in carbon intensity across office
operations (tCO2e per square foot).
Developed a strategy to mitigate the carbon impacts of our marketplace which includes taking
immediate action to balance our footprint:
Utilize and source energy responsibly so that
we can power our operations with 100%
renewable electricity by 2020 and reduce the
intensity of our energy use by 25% by 2025
In 2018, develop a plan and set a goal
to mitigate the carbon impacts of our
marketplace that aligns with business
growth
- In February 2019, we announced that we will offset 100% of our emissions from shipping
through investment in verified emissions reductions, and,
Mitigate the ecological impact of our
marketplace by offering carbon neutral
shipping on 100% of transactions by 2020
- We plan to activate levers of change that will help to drive carbon reduction in the long
term, including policy advocacy, vendor negotiation and peer collaboration.
Run zero waste operations by 2020
Diverted 95% of waste from global operations from landfill or incineration, up from 87% in 2017.
Run zero waste operations by 2020
18
Etsy’s mission to “Keep Commerce Human” means that we celebrate the uniqueness, authenticity, and richness of the human experience. Our diversity & inclusion efforts
are integral to who we are as a company; namely, one that is in the business of servicing and celebrating the vibrant spectrum of unique and special qualities people possess.
We are committed to reporting transparently on workforce diversity at Etsy. All metrics below are as of December 31 of the stated year. Leadership is defined as Director
level and above. Tech employees are defined as those employees who work on Product, Engineering, Analytics and HR Information and Financial Systems Administration
teams. Other business roles are defined as those employees who work in roles outside of the Tech definition, and is inclusive of non-tech Leadership positions. Gender and
age metrics represent Etsy’s global employee base, while race and ethnicity metrics represent U.S. employees only.
Board
Overall
Leadership
Tech
Engineering
Other Business Roles
† Etsy commissioned an external third party to perform attest procedures with respect to our diversity metrics for the period from January 1, 2018 to December 31, 2018.
19
Black/African American
Hispanic
Two or More Races
White
Not Declared
American Indian or Alaska Native
—%
0.2%
0.1%
—%
—%
—%
—%
—%
—%
—%
—%
—%
Asian
13.2% 13.9% 16.5% 11.4% 16.9% 19.3% 18.0% 20.9% 22.6% 17.7% 20.4% 21.9%
RACE & ETHNICITY METRICS - U.S. ONLY
Overall
Leadership
Tech
Engineering
Other Business Roles
2016
2017
2018†
2016
2017
2018†
2016
2017
2018†
2016
2017
2018†
2016
2017
2018†
—%
9.0%
4.5%
3.6%
2.9%
0.3%
7.0%
5.4%
3.8%
3.5%
0.3%
8.5%
5.5%
5.2%
2.7%
3.9%
4.1%
3.5%
4.4%
4.1%
2.7%
3.7%
4.8%
2.8%
2.5%
1.3%
5.1%
3.4%
1.7%
5.1%
3.4%
—%
2.3%
3.2%
4.4%
4.2%
3.3%
4.5%
2.1%
2.6%
4.7%
3.0%
3.3%
3.9%
4.6%
4.2%
4.2%
2.0%
3.2%
5.1%
3.2%
73.9% 71.8% 67.0% 78.5% 72.9% 75.0% 68.4% 65.6% 60.8% 68.9% 65.0% 60.8% 78.6% 78.1% 74.8%
1.4%
2.9%
5.1%
1.2%
—%
—%
1.8%
3.6%
6.3%
1.6%
4.2%
5.8%
1.4%
1.9%
3.0%
AGE METRICS - GLOBAL
24 years and younger
25-29 years
30-34 years
35-39 years
40-49 years
50+ years
2016
2017
2018†
5.7%
4.2%
5.3%
29.2% 28.4% 27.9%
35.8% 34.1% 32.2%
19.0% 21.2% 20.8%
8.3%
1.9%
9.4% 11.1%
2.7%
2.7%
† Etsy commissioned an external third party to perform attest procedures with respect to our diversity metrics for the period from January 1, 2018 to December 31, 2018.
20
SASB Disclosure
The Sustainability Accounting Standards Board’s (SASB) mission is to develop sustainability metrics for public corporations to
disclose material, decision-useful information to investors. Etsy supports work that contributes directly to generating
comparable and consistent data. We have considered SASB’s Consumer Goods Sector – E-Commerce industry standard and
have provided key details below.
SASB Metrics
SASB Code Metric
CG-EC-000.A
Entity-defined measure of
user activity
Active buyers (thousands)
Active sellers (thousands)
2016
28,566
1,748
2017
33,364
1,933
2018
39,447
2,115
CG-EC-000.B
Data processing capacity
In December 2017, we announced our Google Cloud Partnership, an initiative that will
transition our infrastructure to the Google Cloud Platform. We are currently in the process of
migrating our colocated data centers to Google Cloud. In 2018, we successfully migrated our
website and mobile apps to the platform, and we expect to complete the migration by the
beginning of 2020.
Percentage outsourced
100%
100%
100%
Hardware Infrastructure Energy & Water Management
CG-EC-130a.1
Total energy consumed, MWh
Percentage renewable energy
Percentage grid electricity
6,155
—%
100%
7,111
32%
100%
7,330
65%
100%
CG-EC-130.a
Discussion of the integration of environmental considerations into strategic planning for data center needs. Etsy’ s goals
include powering our operations with 100% renewable electricity by 2020, and reducing the intensity of our energy use by
25% by 2025. These goals are included as key considerations as we plan for our computing needs, and have been a focus
of our sustainability efforts. When transitioning to a cloud computing infrastructure, we selected Google Cloud Platform, a
partner that shares our commitment to 100% renewable electricity. Their highly efficient data centers are expected to help
us save significant energy. Moreover, moving to flexible cloud-based infrastructure should enable us to reduce major idle
time and associated energy consumption.
In 2018, Etsy entered into a virtual power purchase agreement for solar energy in Virginia. Once operational, this project is
expected to provide us with renewable attributes to apply to our operations and computing infrastructure, furthering our
goals of creating a cleaner internet and reducing our impact on the planet. We actively monitor and manage energy
consumption from our computing infrastructure. In 2018, our colocated data centers accounted for 68% of total energy
consumed, or 7330 MWh.
Data Privacy and Advertising Standards
CG-EC-220a.2
Description of the policies and practices relating to behavioral advertising and user privacy. We care deeply about privacy
and we’ re committed to being upfront about our privacy practices, including how we treat personal information. Etsy’ s
Privacy Policy provides a detailed explanation of our privacy practices. Among other things, our Privacy Policy covers the
user information that Etsy collects or receives, the choices and control that a user has in relation to this data including
based on type and sensitivity, the purpose for which Etsy uses such information (including first and third party advertising
purposes), our policies relating to our usage and sharing within Etsy and its affiliates, and user controls for sharing and
controlling such information with third parties.
Data Security
CG-EC-230a.1
Description of approach to identifying and addressing data security risks. Data security is overseen by our Chief
Information Security Officer who reports to our Chief Technical Officer. We strive to protect sensitive information through
various means, such as technical safeguards, procedural requirements and policies, an intensive program of monitoring on
both our web platform and within our corporate network, continuous testing of aspects of our security posture internally
and with outside vendors, a robust incident response program, and regular training for employees.
Employee Recruitment, Inclusion and Performance
CG-EC-330a.1
Employee engagement as a percentage
80%
60%
70%
Employee engagement as a percentage and discussion of methodology. In July 2018, Etsy conducted an engagement
survey of all global employees. Of employees surveyed, 82% submitted a response. The survey was conducted through the
Culture Amp platform and consisted of 48 questions - 45 rating questions on which employees were asked to indicate their
level of agreement with a statement based on a five-point scale from Strongly Agree to Strongly Disagree, and three free-
text questions to which employees were asked to write out a response. The responses were analyzed against the results
from a similar survey conducted in 2017, as well as Culture Amp's 2018 New Tech - 500+ Benchmark, which consists of
survey results from companies that are primarily internet-based or focused on creating new technologies, and that have
between 500 and 5,000 employees.
Gender and racial/ethnic group representation for leadership,
technical staff and other business functions
See Impact Strategy section for detailed metrics.
Discussion of diversity and inclusion strategy and performance
See Impact Strategy - Social Impact for details.
CG-EC-330a.3
CG-EC-330a.4
Percentage of technical employees who are H-1B visa holders
2.5%
21
SASB Metrics
SASB Code Metric
Product Packaging and Distribution
2016
2017
2018
CG-EC-410a.1
CG-EC-410a.2
Total greenhouse gas (GHG) footprint of product shipments in metric
tons CO2e
Discussion of strategies to reduce the environmental impact of product delivery. The delivery of products sold on our
marketplace represents the majority of Etsy’ s carbon footprint. As a peer-to-peer marketplace, Etsy does not directly control
seller shipping or the associated logistics networks, however, we are committed to addressing carbon emissions from
shipping. We have identified a number of levers that we expect to help to drive carbon reduction in the long term, including
policy advocacy, vendor negotiation, and peer collaboration. In the near term, Etsy recognizes the need to act on climate
change and we are taking immediate action to help balance our footprint. In 2019, we are committing to offset 100% of our
emissions from shipping through investments in verified emissions reductions.
118,153‡
103,646‡
135,459†
Greenhouse Gas (“GHG”) Emissions Summary (tCO2e)
2016
2017
2018
GHG Emissions by Scope
Scope 1
Scope 2 - Market
Scope 2 - Location
Scope 3
Scope 3 GHG Emissions by Activity Source
Shipping
Air Travel
Commuting
Remote Workers
Waste
Water
Electricity, Transmission and Distribution Losses
410‡
2,946‡
3,076‡
467‡
2,209‡
3,152‡
372†
1,213†
2,923†
105,295
119,444
137,042
103,646‡
118,153‡
135,459†
967‡
597
49
18
9
9
550‡
663
64
7
4
3
943†
544
87
6
3
<1
† Etsy commissioned an external third party to perform attest procedures with respect to our carbon and energy metrics for the period from
January 1, 2018 to December 31, 2018. Full details and data methodology are available at investors.etsy.com.
‡ Metrics for which historical data has also been subject to previous attest procedures.
22
Competition
We compete for Etsy sellers with both retailers and companies that sell software to small businesses. An Etsy seller can list her
goods for sale with online retailers or sell her goods through local consignment and vintage stores and other venues and
marketplaces, including through commerce channels on social networks like Facebook and Instagram. She may also sell
wholesale directly to traditional retailers, including large national retailers, who discover her goods in our marketplace or
otherwise. We also compete with companies that sell software and services to small businesses, enabling an Etsy seller to sell
from her own website or otherwise run her business independently of our platform. We are able to compete for Etsy sellers
based on our brand awareness, the global scale of our marketplace and the breadth of our online presence, the number and
engagement of Etsy buyers, our seller tools and services, our seller education resources, our policies and fees, our mobile apps,
the strength of our community, and our values.
We also compete with retailers for the attention of the Etsy buyer. An Etsy buyer has the choice of shopping with any online or
offline retailer, whether large marketplaces or national retail chains or local consignment and vintage stores or other venues or
marketplaces. We are able to compete for Etsy buyers based on the unique goods that Etsy sellers list in our marketplace, our
brand awareness, the person-to-person commerce experience, customer service, our reputation as a trusted marketplace, our
mobile apps, the availability of fair and free shipping offered by Etsy sellers, ease of payment, and the availability and
reliability of our platform.
Intellectual Property
Protection of our technology and intellectual property is an important component of our success. We rely on intellectual
property laws, including patent, trade secret, copyright, and trademark laws, in the United States and abroad. We also use
confidentiality procedures, defensive licensing and acquisitions, non-disclosure agreements, invention assignment agreements,
and other contractual rights to protect Etsy and our intellectual property.
We file patents and register domain names, trademarks, copyrights, and service marks in the United States and abroad. We rely
upon unregistered copyrights and common law protection for certain trademarks. We also use internal and external brand
protection mechanisms that are intended to protect Etsy’s brand from misuse by third parties.
Government Regulation
As with any company operating on the internet, we are subject to a growing number of local, national, and international laws
and regulations. These laws are often complex, sometimes contradict other laws, and are frequently changing. Laws may be
interpreted and enforced in different ways in various locations around the world, posing a significant challenge to our global
business. For example, U.S. federal and state laws, E.U. directives, and other national laws govern the processing of payments,
consumer protection, and the privacy of consumer information; other laws define and regulate unfair and deceptive trade
practices. Still other laws dictate when and how sales or other taxes must be collected. Laws of defamation apply online and
vary by country. The growing regulation of e-commerce worldwide could impose additional compliance burdens and costs on
us or on Etsy sellers and could subject us to significant liability for any failure to comply. Additionally, because we operate
internationally, we need to comply with various laws associated with doing business outside of the United States, including
anti-money laundering, sanctions, anti-corruption, and export control laws.
23
Available Information
We are subject to the informational requirements of the Securities Exchange Act of 1934, as amended, (“the Exchange Act”),
and file or furnish reports, proxy statements and other information with the Securities and Exchange Commission, (the “SEC”).
Our Annual Report on Form 10-K, Quarterly Reports on Form 10-Q, Current Reports on Form 8-K, and amendments to these
reports are available free of charge on our website at investors.etsy.com as soon as reasonably practicable after we have filed or
furnished them to the SEC. The information on our website is not incorporated into this Annual Report and investors should not
rely on such information in deciding whether to invest in our common stock. Copies of our SEC reports and other documents
are also available, without charge, by sending a letter to Investor Relations, Etsy, Inc., 117 Adams Street, Brooklyn, NY 11201,
by sending an email to ir@etsy.com or by calling (347) 382-7582.
Our SEC reports are also available on the SEC’s website at www.sec.gov free of charge as soon as reasonably practicable after
we have filed or furnished them to the SEC. For information regarding classes of products or services that accounted for 10%
or more of consolidated revenue in the last three fiscal years, see “Management’s Discussion and Analysis of Financial
Condition and Results of Operations—Results of Operations.”
24
Item 1A. Risk Factors.
Investing in our common stock involves a high degree of risk. You should consider carefully the risks and uncertainties
described below, our Consolidated Financial Statements and related notes, and the other information in this Annual Report on
Form 10-K. If any of these risks actually occur, our business, financial condition, results of operations, and prospects could be
adversely affected. As a result, the price of our common stock could decline and you could lose part or all of your investment.
Risks Related to Our Business and Industry
Our quarterly operating results may fluctuate, which could cause our stock price to decline.
Our quarterly operating results, as well as our key metrics, may fluctuate for a variety of reasons, many of which are beyond
our control, including:
•
•
•
•
•
•
•
•
•
•
•
•
•
fluctuations in revenue generated from Etsy sellers on our platform, including as a result of the seasonality of market
transactions, and Etsy sellers’ use of services;
our ability to convert visits to Etsy.com into sales for our sellers;
the amount and timing of our operating expenses;
our success in attracting and retaining Etsy sellers and Etsy buyers;
our success in executing on our strategy and the impact of any changes in our strategy;
the timing and success of product launches, including new services and features we may introduce;
the success of our marketing efforts;
economic and market conditions, such as currency fluctuations and global events;
disruptions or defects in our marketplace, such as privacy or data security breaches or other incidents that impact the
reliability of our platform;
the impact of competitive developments and our response to those developments;
our ability to manage our existing business and future growth;
our ability to recruit and retain employees; and
the impact of our revised global corporate structure that was implemented on January 1, 2015.
Fluctuations in our quarterly operating results and key metrics may cause those results to fall below our financial guidance or
other projections, or the expectations of analysts or investors, which could cause the price of our common stock to decline.
Fluctuations in our results could also cause a number of other problems. For example, analysts or investors might change their
models for valuing our common stock, we could experience short-term liquidity issues, our ability to retain or attract key
personnel may diminish, and other unanticipated issues may arise.
In addition, we believe that our quarterly operating results and key metrics may vary in the future and that period-to-period
comparisons of our operating results may not be meaningful. For example, our overall historical growth rate may have
overshadowed the effect of seasonal variations on our historical operating results. These seasonal effects may become more
pronounced over time, which could also cause our operating results and key metrics to fluctuate. You should not rely on the
results of one quarter as an indication of future performance.
If we are unable to successfully execute on our business strategy or if our strategy proves to be ineffective, our business,
financial performance and growth could be adversely affected.
Our ability to execute our strategy is dependent on a number of factors, including the ability of our senior management team
and key team leaders to execute our strategy, our ability to maintain our pace of product experiments coupled with the success
of such initiatives and introduce offerings that meet the changing needs of our sellers and buyers, and the ability of our
employees to perform at a high-level. If we are unable to execute our strategy, if our strategy does not drive the growth that we
25
anticipate, or if our market opportunity is not as large as we have estimated, it could adversely affect our business, financial
performance and growth.
Our business, financial performance and growth depends on our ability to attract and retain an active and engaged
community of Etsy buyers and Etsy sellers.
Our financial performance has been and will continue to be significantly determined by our success in attracting and retaining
active buyers and active sellers. For example, our revenue is driven by the number of the number of active buyers and buyer
engagement, as well as active sellers and seller engagement. We must encourage buyers to return to Etsy and purchase items in
our marketplace more frequently. We must also continue to encourage Etsy sellers to list items for sale and use our services.
We believe that many new Etsy buyers and Etsy Sellers find Etsy by word of mouth and other non-paid referrals from existing
Etsy buyers and Etsy Sellers. If existing Etsy buyers do not find our platform appealing, whether because of a negative
experience, lack of competitive shipping costs, inadequate customer service, lack of buyer-friendly features, declining interest
in the nature of the goods offered by Etsy sellers, or other factors, they may make fewer purchases and they may stop referring
others to us. Likewise, if existing Etsy sellers are dissatisfied with their experience on our platform, they may stop listing items
in our marketplace and using our services and may stop referring others to us. Under any of these circumstances, we may have
difficulty attracting new Etsy buyers and Etsy sellers without incurring additional expense.
Our GMS and revenue is concentrated in our most active buyers and sellers. If we lose those buyers and sellers, our financial
performance and growth could be harmed. Even if we are able to attract new Etsy buyers and Etsy sellers to replace the ones
that we lose, they may not maintain the same level of activity, and the GMS and revenue generated from new Etsy buyers and
Etsy sellers may not be as high as the GMS and revenue generated from the ones who leave our marketplace. If we are unable
to retain existing Etsy buyers and Etsy sellers and attract new Etsy buyers and Etsy sellers who contribute to an active
community, our business, financial performance, and growth would be harmed.
Additionally, the demand for the goods listed in our marketplace is dependent on consumer preferences which can change
quickly and may differ across generations and cultures. If demand for the goods that Etsy sellers offer declines, we may not be
able to attract and retain Etsy buyers and our business would be harmed. Trends in socially-conscious consumerism and buying
unique rather than mass produced goods could also shift or slow which would make it more difficult to attract new Etsy buyers
and Etsy sellers. Our growth would also be harmed if the shift to ecommerce does not continue.
We have a history of losses and we may not achieve or maintain profitability in the future.
We generated net income of $77.5 million and $81.8 million and incurred a net loss of $29.9 million for the years ended
December 31, 2018, 2017, and 2016, respectively. We may not maintain profitability in the future. Our costs may increase as
we continue to invest in the development of our platform, including our services and technological enhancements, and increase
our marketing efforts, expand our operations, and hire additional employees. These efforts may be more costly than we expect
and our revenue may not increase sufficiently to offset these additional expenses. In addition, our revenue may decline for a
number of reasons, including those described elsewhere in these Risk Factors.
Further, our revenue growth rate may decelerate in the future for a number of reasons, including the deceleration of our GMS
growth rate. For further information about the rate of revenue and GMS growth, see “Management’s Discussion and Analysis
of Financial Condition and Results of Operations—Results of Operations—Revenue.” You should not rely on growth rates of
prior periods as an indication of our future performance.
Our business could be adversely affected by economic downturns, natural disasters, public health crises, political crises
or other unexpected events.
Macroeconomic conditions may adversely affect our business. If general economic conditions deteriorate in the United States
or other markets where we operate, consumer discretionary spending may decline and demand for the goods and services
available in our platform may be reduced. This would cause our Marketplace and Services revenue to decline and adversely
impact our business. Conversely, if recent trends supporting self-employment and the desire for supplemental income were to
reverse, the number of Etsy sellers offering their goods in our marketplace could decline and the number of goods listed in our
marketplace could decline. In addition, currency exchange rates may directly and indirectly impact our business. For example,
continued uncertainty around the United Kingdom’s decision to exit the European Union, or E.U., commonly referred to as
Brexit, may result in future exchange rate volatility, which may strengthen the U.S. dollar against foreign currencies. If the U.S.
dollar strengthens against foreign currencies, our translation of foreign currency denominated GMS and revenue will result in
lower U.S. denominated GMS and revenue. Currency exchange rates may also dampen demand from buyers outside the United
26
States for goods denominated in U.S. dollars, which could impact GMS and revenue. For the year ended December 31, 2018,
approximately 83% of our GMS was denominated in U.S. dollars.
Natural disasters and other adverse weather and climate conditions, public health crises, political instability or crises, terrorist
attacks, war, or other unexpected events, could disrupt our operations, internet or mobile networks, or the operations of one or
more of our third-party service providers. Certain events, such as hurricanes and other natural disasters and political instability,
are likely to impact buyer behavior for discretionary goods and sellers’ ability to run their businesses on our marketplace and
ship their goods. These kinds of events may also impact consumer perceptions of well-being and security, which may adversely
impact consumer discretionary spending. If any of these events occurs, our business could be adversely affected.
Our ability to recruit and retain employees is important to our success.
Our ability to attract, retain, and motivate employees, including our management team, is important to our success. We strive to
attract, retain, and motivate employees, from our office administrators to our management team, who share our dedication to
our community and our mission to “Keep Commerce Human.” We cannot guarantee we will continue to attract and retain the
number or caliber of employees we need to maintain our competitive position.
Some of the challenges we face in attracting and retaining employees include:
•
•
•
•
•
•
•
•
perceived uncertainties as to our commitment to our mission, guiding principles and culture;
skepticism regarding our ability to continue to accelerate GMS growth in the future;
continuing to offer competitive compensation and benefits;
enhancing engagement levels among existing employees and supporting their work-life balance;
attracting and retaining qualified employees who support our mission and guiding principles;
promotion opportunities for employees into leadership positions ;
hiring employees in multiple locations globally; and
responding to competitive pressures and changing business conditions in ways that do not divert us from our guiding
principles.
Filling engineering, product management, and other technical positions, particularly in New York City and San Francisco, is
challenging. Qualified individuals are limited and in high demand, and we may incur significant costs to attract, develop, and
motivate them. Even if we were to offer higher compensation and other benefits, people with suitable technical skills may
choose not to join us or to continue to work for us. In addition, job candidates and existing employees often consider the value
of the stock awards they receive in connection with their employment. If the perceived value of our stock awards declines, it
may adversely affect our ability to recruit and retain highly skilled employees.
In general, our employees, including our management team, work for us on an at-will basis. The unexpected loss of or failure to
retain one or more of our key employees, such as our Chief Executive Officer, Chief Financial Officer or Chief Technology
Officer, or unsuccessful succession planning, could adversely affect our business. Other companies, including our competitors,
may be successful in recruiting and hiring our employees, and it may be difficult for us to find suitable replacements on a
timely basis or on competitive terms.
If we experience increased voluntary attrition in the future and if we are unable to attract and retain qualified employees,
particularly in critical areas of operations such as engineering, we may not achieve our strategic goals and our business and
operations could be harmed.
The trustworthiness of our marketplace and the connections within our community are important to our success. If we
are unable to maintain them, our ability to attract and retain Etsy sellers and Etsy buyers could suffer.
We have built a trusted marketplace that embodies our values-based culture and continue to focus on ensuring that we deliver
trust and reliability throughout the buyer experience on Etsy.com. Our reputation depends upon our Etsy sellers, their unique
offerings and their adherence to our policies.
27
The trustworthiness of our marketplace and the connections among the members of our community are the cornerstones of our
business. Many things could undermine these cornerstones, such as:
•
•
•
•
•
•
•
•
•
•
complaints or negative publicity about us, our platform or our policies and guidelines, even if factually incorrect or based
on isolated incidents;
an inability to gain the trust of prospective buyers;
disruptions or defects in our marketplace, such as the increased pace of product experimentation, privacy or data security
breaches, website outages, payment disruptions or other incidents that impact the reliability of our platform;
lack of awareness of our policies or confusion about how they are applied;
changes to our policies that members of our community perceive as inconsistent with their best interests or our mission, or
that are not clearly articulated;
inadequacies in our terms of use;
a failure to enforce our policies effectively, fairly and transparently, including, for example, by allowing the widespread
listing of prohibited items in our marketplace;
inadequate or unsatisfactory customer service experiences;
a failure to respond to feedback from our community; or
a failure to operate our business in a way that is consistent with our guiding principles and mission.
In particular, we are focused on enhancing customer service for Etsy sellers and Etsy buyers and have migrated our legacy
support platform to a new third-party customer service platform. We plan to introduce new customer service features and tools
to support a positive user experience on our platform. If our efforts to enhance customer service are unsuccessful or if our new
customer service platform fails to meet our needs, we may need to invest additional resources in customer service and our
ability to maintain a trustworthy marketplace could be harmed.
If we are unable to maintain a trustworthy marketplace and encourage connections among members of our community, then our
ability to attract and retain Etsy sellers and Etsy buyers could be impaired and our reputation and business could be adversely
affected.
If we are not able to keep pace with technological changes and enhance our current offerings and develop new offerings
to respond to the changing needs of Etsy sellers and Etsy buyers, our business, financial performance and growth may
be harmed.
Our industry is characterized by rapidly changing technology, new service and product introductions, and changing customer
demands and we are not able to predict the effect of these changes on our business. The technologies that we currently use to
support our platform may become inadequate or obsolete and the cost of incorporating new technologies into our products and
services may be substantial. We strive to respond to evolving customer needs and regularly launch new products, features and
services including, for example, our recently announced seller subscription packages and tools. Etsy sellers and Etsy buyers,
however, may not be satisfied with our enhancements or new offerings or may perceive that these offerings do not respond to
their needs or create value for them. Additionally, as we experiment with new offerings or changes to our platform, Etsy sellers
and Etsy buyers may find these changes to be disruptive and may perceive them negatively. In addition, developing new
services and features is complex, and the timetable for public launch is difficult to predict and may vary from our historical
experience. As a result, the introduction of new offerings may occur after anticipated release dates or they may be introduced as
pilot programs, which may not be continued for various reasons. In addition, new offerings may not be successful due to
defects or errors, negative publicity, or our failure to market them effectively.
New offerings may not drive GMS or revenue growth, may require substantial investment and planning, and may bring us more
directly into competition with companies that are better established or have greater resources than we do.
If we do not continue to cost-effectively develop new offerings that satisfy Etsy sellers and Etsy buyers, then our competitive
position and growth prospects may be harmed. In addition, new offerings may have lower margins than existing offerings and
our revenue from the new offerings may not be enough to offset the cost of developing them, which could adversely affect our
business, financial performance and growth.
28
Our marketing efforts to help grow our business may not be effective.
Maintaining and promoting awareness of our marketplace and services is important to our ability to attract and retain Etsy
sellers and Etsy buyers. One of the key parts of our strategy is to create more habitual buyers by inspiring purchases across
multiple categories and special occasions. In addition, one of the primary goals of our 2018 pricing increase was to enable us to
make further investments in marketing designed to attract more buyers to Etsy. Generating a meaningful return on our
investments in marketing initiatives, however, may be difficult, particularly as we anticipate that our marketing investments
will be more speculative in the future. In addition, there can be no assurance that we will deploy additional funds resulting from
our 2018 pricing increase effectively.
The marketing efforts we implement may not succeed for a variety of reasons, including our inability to execute and implement
our plans. External factors beyond our control may also impact the success of our marketing initiatives. Our primary marketing
efforts currently include search engine optimization, search engine marketing, affiliate marketing and display advertising, as
well as, social media, mobile push notifications, and email. Additionally, we have begun experimenting with television and
digital video advertising. We obtain a significant number of visits via search engines such as Google. Search engines frequently
change the algorithms that determine the ranking and display of results of a user’s search and may make other changes to the
way results are displayed, which can negatively affect the placement of links to our marketplace and, therefore, reduce the
number of visits to our marketplace. In addition, search engines and other third-parties typically require compliance with their
policies and procedures, which may be subject to change or new interpretation with limited ability to negotiate, which could
negatively impact our marketing capabilities and GMS. The growing use of online ad-blocking software, including on mobile
devices, may also impact the success of our marketing efforts because we may reach a smaller audience and fail to bring more
Etsy buyers to our platform. In addition, ongoing privacy regulatory changes, such as the E.U. General Data Protection
Regulation, may impact the scope and effectiveness of marketing and advertising services generally, including those used on
our platform.
We also obtain a significant number of visits through email. If we are unable to successfully deliver emails to Etsy sellers and
Etsy buyers, or if Etsy sellers and Etsy buyers do not open our emails, whether by choice, because those emails are marked as
low priority or spam, or for other reasons, our business could be adversely affected. Social networking websites, such as
Facebook and Pinterest, are another important source of visits to our marketplace. As ecommerce and social networking evolve,
we must continue to evolve our marketing tactics accordingly and, if we are unable to do so, our business could be adversely
affected.
If the mobile solutions available to Etsy sellers and Etsy buyers are not effective, the use of our marketplace could
decline.
Purchases made on mobile devices by consumers, including Etsy buyers, have increased significantly in recent years. The
smaller screen size and reduced functionality associated with some mobile devices may make the use of our platform more
difficult or less appealing. Etsy sellers are also increasingly using mobile devices to operate their businesses on our platform. If
we are not able to deliver a rewarding experience on mobile devices, Etsy sellers’ ability to manage and scale their businesses
may be harmed and, consequently, our business may suffer. Further, although we strive to provide engaging mobile experiences
for both Etsy sellers and Etsy buyers who visit our mobile website using a browser on their mobile device, we depend on Etsy
sellers and Etsy buyers using our mobile apps for the optimal mobile experience. Mobile web conversion rate is about half the
conversion rate on desktop and the conversion rate on our mobile Buy on Etsy app is about 1.2x the desktop conversion rate.
Therefore, if mobile web visits continue to grow as a percentage of overall visits, it could be a headwind to future conversion
rate gains and result in less GMS and revenue for us.
As new mobile devices and mobile platforms are released, we may encounter problems in developing or supporting apps for
them. In addition, supporting new devices and mobile device operating systems may require substantial time and resources.
The success of our mobile apps could also be harmed by factors outside our control, such as:
•
•
•
•
actions taken by providers of mobile operating systems or mobile app download stores;
unfavorable treatment received by our mobile apps, especially as compared to competing apps, such as the placement of
our mobile apps in a mobile app download store;
increased costs to distribute or use our mobile apps; or
changes in mobile operating systems, such as iOS and Android, that degrade the functionality of our mobile website or
mobile apps or that give preferential treatment to competitive products.
29
If Etsy sellers and Etsy buyers encounter difficulty accessing or using our platform on their mobile devices, or if they choose
not to use our platform on their mobile devices, our business, financial performance, and growth may be adversely affected.
Expanding our community outside of the United States is part of our strategy and the growth of our business could be
harmed if our expansion efforts do not succeed.
Our vision is both global and local and we are focused on growing our business outside of the United States. Although we have
a significant number of Etsy sellers and Etsy buyers outside of the United States, we are a U.S.-based company with less
experience developing local markets outside the United States and may not execute our strategy successfully. Operating outside
of the United States also requires significant management attention, including managing operations over a broad geographic
area with varying cultural norms and customs, and adapting our platform to local markets.
Despite our execution efforts, the goods that Etsy sellers list on Etsy.com may not appeal to non-U.S. consumers in the same
way as they do to consumers in the United States. In addition, non-U.S. buyers are not as familiar with the Etsy brand as buyers
in the United States and may not perceive us as relevant or trustworthy. Also, visits to Etsy.com from Etsy buyers outside the
United States may not convert into sales as often as visits from within the United States, including due to the impact of the
strong U.S. dollar relative to other currencies and the fact that most of the goods listed on our platform are denominated in U.S.
dollars.
Our ability to grow our international operations may also be adversely affected by any circumstances that reduce or hinder
cross-border trade. For example, the shipping of goods cross-border is typically more expensive and slower than domestic
shipping and often involves complex customs and duty inspections and the dependency of national postal carrier systems.
Our success outside the United States depends upon our ability to attract Etsy sellers and Etsy buyers from the same countries
in order to enable the growth of local markets. If we are not able to expand outside of the United States successfully, our
growth prospects could be harmed. An inability to develop Etsy’s community globally or to otherwise grow our business
outside of the United States on a cost-effective basis could adversely affect our GMS, revenue, and operating results.
Competition is also likely to intensify outside of the United States, both where we operate now and where we plan to expand
our operations. Local companies based outside the United States may have a substantial competitive advantage because of their
greater understanding of, and focus on, their local markets. Some of our competitors may also be able to develop and grow
internationally more quickly than we will.
Continued expansion outside of the United States may also require significant financial investment. For example, in June 2018,
we announced a referral agreement with DaWanda, a German e-commerce marketplace, which encouraged the migration of
DaWanda buyers and sellers to Etsy’s marketplace and helped expand Etsy’s presence in Central Europe. Etsy also made initial
investments to explore growth opportunities in India, a dynamic market where we have limited operating experience. We plan
to invest in seller and buyer acquisition marketing, enhancing our machine translation and machine learning to help sellers and
buyers connect even if they do not speak the same language, forming relationships with third-party service providers,
supporting operations in multiple countries, and potentially acquiring companies based outside the United States and
integrating those companies with our operations. Our investment outside of the United States may be more costly than we
expect or unsuccessful.
Further expansion outside of the United States will subject us to risks associated with operations abroad.
Doing business outside of the United States subjects us to increased risks and burdens such as:
•
•
•
•
•
complying with different (and sometimes conflicting) laws and regulatory standards (particularly including those related to
the use and disclosure of personal information, online payments and money transmission, intellectual property, consumer
protection, online platform liability and taxation of goods and services);
fluctuations of foreign exchange rates;
potentially heightened risk of fraudulent or other illegal transactions;
limitations on the repatriation of funds;
exposure to liabilities under anti-corruption, anti-money laundering and export control laws, including the U.S. Foreign
Corrupt Practices Act of 1977, as amended, the U.K. Bribery Act of 2010, trade controls and sanctions administered by the
U.S. Office of Foreign Assets Control, and similar laws and regulations in other jurisdictions;
30
•
•
•
•
•
varying levels of internet, e-commerce, and mobile technology adoption and infrastructure;
our ability to enforce contracts and intellectual property rights in jurisdictions outside the United States;
geopolitical events such as natural disasters, terrorism and acts of war;
uncertainties and instability in European markets caused by Brexit; and
barriers to international trade, such as tariffs, customs or other taxes.
Etsy sellers face similar risks in conducting their businesses across borders. Even if we are successful in managing the risks of
conducting our business across borders, if Etsy sellers are not, our business could be adversely affected. In particular, Etsy
buyers and sellers seeking to engage in cross-border sales may become subject to an increasing number of barriers to
international trade such as tariffs, customs or other taxes.
If we invest substantial time and resources to expand our operations outside of the United States and cannot manage these risks
effectively, the costs of doing business in those markets may be prohibitive or our expenses may increase disproportionately to
the revenue generated in those markets.
Legal, political and economic uncertainty surrounding the planned exit of the United Kingdom from the European
Union may be a source of instability in international markets, create significant currency fluctuations, adversely affect
our operations in the United Kingdom and pose additional risks to our business, revenue, financial condition, and
results of operations.
On March 29, 2017, the United Kingdom formally notified the European Council of its intention to leave the E.U. It is unclear
how long it will take to negotiate a withdrawal agreement, but it appears likely that Brexit will continue to involve a process of
lengthy negotiations between the United Kingdom and E.U. member states to determine the future terms of the United
Kingdom’s relationship with the E.U.
Lack of clarity about future U.K. laws and regulations as the United Kingdom determines which E.U. rules and regulations to
replace or replicate in the event of a withdrawal, including financial laws and regulations, tax and free trade agreements,
intellectual property rights, supply chain logistics, environmental, health and safety laws and regulations, immigration laws and
employment laws, could decrease foreign direct investment in the United Kingdom, increase costs, depress economic activity,
and restrict access to capital. In addition, depending on the terms of the United Kingdom’s withdrawal from the E.U., the
United Kingdom could lose the benefits of global trade agreements negotiated by the E.U. on behalf of its members. The long-
term effects of Brexit will depend on any agreements (or lack thereof) between the United Kingdom and the E.U. and, in
particular, any arrangements for the United Kingdom to retain access to E.U. markets either during a transitional period or more
permanently.
Such a withdrawal from the E.U. is unprecedented, and it is unclear how the United Kingdom’s access to the European single
market for goods, capital, services and labor within the E.U., or the European single market, and the wider commercial, legal
and regulatory environment, will impact our U.K. operations, including our sellers and buyers in the United Kingdom. We may
also face new regulatory costs and challenges that could have an adverse effect on our operations. The announcement of Brexit
has already created economic uncertainty, and its consequences could adversely impact our business, revenue, financial
condition, and results of operations.
Regulation in the areas of privacy and protection of user data could harm our business.
In addition to the actual and potential changes in law described elsewhere in these Risk Factors, global developments in privacy
and data security regulations are changing some of the ways we and our vendors collect, use, and share personal information.
Compliance with these changing regulations have necessitated some specific product changes for our non-U.S. activities. In
May 2018, the General Data Protection Regulation (“GDPR”) went into effect in the E.U., effectively extending the scope of
E.U. data protection law to all non-E.U. companies processing data of E.U. persons. The GDPR seeks to harmonize the data
protection regulations throughout the entire E.U. The regulation contains numerous requirements and changes from existing
E.U. law, including more robust obligations on data processors, greater rights for data subjects (requiring potentially significant
changes to both our technology and operations), security and accountability obligations, and significantly heavier
documentation and record-keeping requirements for data protection compliance programs. Specifically, the GDPR introduced
numerous privacy-related changes for companies operating in the E.U., including greater control over personal data by data
subjects (e.g., the “right to be forgotten”), increased data portability, access and redress rights for E.U. consumers, data breach
notification requirements, increased rules for online and e-mail marketing, and stronger regulatory enforcement regimes. The
31
GDPR requirements apply to some third-party transactions (such as commercial contracts with partners and vendors) and to
transfers of information between us and our subsidiaries, including user and employee information. GDPR requirements may
also apply, depending on interpretation of its reach, to some users in Etsy’s worldwide community of sellers. We may
experience difficulty retaining or obtaining new E.U. sellers or new sellers selling into the E.U. due to the legal requirements,
compliance cost, potential risk exposure, and uncertainty for them in respect of their own compliance obligations with respect
to GDPR. In addition, although Etsy sellers are independent businesses, it is possible that a privacy authority could deem Etsy
jointly and severally liable for actions of Etsy sellers, which would increase our potential liability exposure and costs of
compliance, which could negatively impact our business. We could face potential liability, regulatory investigation, and costly
litigation, which may not be adequately covered by insurance.
GDPR, the recently passed California Consumer Privacy Act, and similar laws coming into effect in other jurisdictions may
continue to change the data protection landscape globally and could result in potentially significant operational costs for
internal compliance and risk to our business. Some of these requirements introduce friction into the buying and selling
experience on Etsy and may impact the scope and effectiveness of our marketing efforts, which could negatively impact our
business and future outlook. Non-compliance with these laws could result in proceedings against us by data protection
authorities, other public authorities, third-parties, or individuals. Under GDPR alone, noncompliance could result in fines up to
20 million Euros or up to 4% of the annual global revenue of the noncompliant company, whichever is greater.
In addition, the laws relating to the transfer of personal data outside of the E.U. continue to evolve and remain uncertain.
Although we are taking steps to comply and mitigate the potential impact to us, the efficacy and longevity of these steps are
uncertain. We may find it necessary to establish systems to maintain personal data originating from the E.U. in the European
Economic Area, which may involve substantial expense and distraction from other aspects of our business. In the meantime, the
evolving data protection landscape also creates uncertainty as to how to comply with E.U. privacy law, including potentially
inconsistent guidance, rulings or requirements from multiple authorities in the E.U., as well as in the U.S. and worldwide.
Further, we may not be entirely successful in our compliance efforts due to various factors either within our control (such as
limited internal resource allocation) or outside our control (such as a lack of vendor cooperation, new regulatory interpretations,
or lack of regulatory guidance in respect of certain GDPR requirements).
Our payments system depends on third-party providers, requires ongoing investment, and is subject to evolving laws,
regulations, rules, and standards.
Etsy buyers primarily pay for purchases using Etsy Payments or PayPal. In the United States and other countries where Etsy
Payments is available, Etsy Payments enables our sellers to accept various forms of payments such as credit cards, debit cards,
PayPal, Google Wallet, Apple Pay, and Etsy Gift Cards.
We rely upon third-party service providers to perform underlying compliance, credit card processing and payment disbursing,
currency exchange, identity verification, sanctions screening, and fraud analysis services. If these service providers do not
perform adequately or if our relationships with these service providers were to terminate, Etsy sellers’ ability to receive orders
or payment could be adversely affected and certain fraud prevention and detection tools may not be effective, which could lead
to potential legal liability and negatively impact our business. In addition, Etsy and our third-party service providers may
experience service outages from time to time that negatively impact payments on Etsy. We have in the past experienced, and
may in the future experience, such service outages and, if we are unable to provide an alternative payment solution, our
business could be harmed. In addition, if our third-party providers increase the fees they charge us, our operating expenses
could increase. If we respond by increasing the fees we charge to Etsy sellers, some Etsy sellers may stop listing new items for
sale or even close their accounts altogether.
The laws and regulations that govern payments are complex, evolving, and subject to change and vary across different
jurisdictions in the United States and globally. Moreover, even in regions where such laws have been harmonized, regulatory
interpretations of such laws may differ. As a result, we are required to spend significant time and effort to determine whether
various laws and licensing regulations relating to payments apply to Etsy and to comply with applicable laws and licensing
regulations. Any failure or claim of our failure to comply, or any failure by our third-party service providers to comply, could
cost us substantial resources, could result in liabilities, could cause us significant reputational damage, or could force us to stop
offering Etsy Payments in certain markets. Additionally, changes in payment regulation may occur that could render our
payments systems less profitable. For example, any significant change in credit or debit card interchange rates in the United
States or other markets, including as a result of changes in interchange fee limitations, may negatively impact payments on
Etsy.
We plan to invest ongoing internal resources into our payments tools in order to maintain its existing availability, expand into
additional markets and offer new payment methods and tools to Etsy buyers and sellers. If we fail to invest adequate resources
32
into payments on Etsy, or if our investment efforts are unsuccessful or unreliable, payments on Etsy may not function properly
or keep pace with competitive offerings, which could negatively impact Etsy Payments usage and our marketplace. Further, our
ability to expand Etsy Payments into additional countries is dependent upon the third-party providers we use to support this
service. As we expand the availability of Etsy Payments to additional markets or offer new payment methods to Etsy sellers and
Etsy buyers in the future, we may become subject to additional regulations, compliance requirements, and exposed to
heightened fraud risk, which could lead to an increase in our operating expenses.
Further, through our agreements with our third-party payment processors, we are indirectly subject to payment card association
operating rules and certification requirements, including the Payment Card Industry Data Security Standard, which are subject
to change. Failure to comply with these rules and certification requirements could impact our ability to meet our contractual
obligations with our third-party payment processors and could result in potential fines. We are also subject to rules governing
electronic funds transfers. Any change in these rules and requirements, including as a result of a change in our designation by
major payment card providers, could make it difficult or impossible for us to comply and could require a change in our business
operations. In addition, similar to a potential increase in costs from third-party providers described above, any increased costs
associated with compliance with payment card association rules or payment card provider rules could lead to increased fees for
Etsy or Etsy sellers, which may negatively impact payments on our platform, usage of Etsy Payments, and our marketplace.
If sensitive information about members of our community or employees is misused or disclosed, or if we or our third-
party providers are subject to cyber attacks, members of our community may curtail use of our platform, we may be
exposed to liability, and our reputation could suffer.
Like all online services, our platform is vulnerable to power outages, telecommunications failures, and catastrophic events, as
well as computer viruses, break-ins, phishing attacks, denial-of-service attacks, and other cyber attacks. Any of these incidents
could lead to interruptions or shutdowns of our platform, loss of data or unauthorized disclosure of personal or financial
information of our members or employees. Cyber attacks could also result in the theft of our intellectual property. As we grow
our business, expand internationally, and gain greater public visibility, we may face a higher risk of being targeted by cyber
attacks. Although we rely on a variety of security measures, including security testing, encryption of sensitive information, and
authentication technology, we cannot assure you that such measures will provide absolute security, particularly given the
increasingly sophisticated tools and methods used by hackers and cyber terrorists. In addition, we have experienced in the past,
and may experience in the future, security breaches as a result of non-technical issues, including intentional, inadvertent, or
social engineering breaches occurring through our employees or employees of our third-party service providers. In addition, if
our employees or employees of our third-party service providers fail to comply with our internal security policies and practices,
member or employee data may be improperly accessed, used, or disclosed.
We are also reliant on the security practices of our third party service providers, which may be outside of our direct control.
Additionally, some of our third party service providers, such as identity verification and payment processing providers,
regularly have access to some confidential and sensitive member data. If these third parties fail to adhere to adequate security
practices, or experience a breach of their networks, our members’ data may be improperly accessed, used or disclosed.
Cyber attacks aimed at disrupting our and our third-party service providers’ services have occurred regularly in the past, and we
expect they will continue to occur in the future. If we or our third-party service providers experience security breaches that
result in marketplace performance or availability problems or the loss or unauthorized disclosure of sensitive information, or if
we fail to respond appropriately to any security breaches that we may experience, people may become unwilling to provide us
the information necessary to set up an account with us. Existing Etsy sellers and Etsy buyers may stop listing new items for
sale, decrease their purchases or close their accounts altogether. We could also face potential liability, regulatory investigation,
costly remediation efforts and litigation, which may not be adequately covered by insurance. Any of these results could harm
our growth prospects, our business, and our reputation for maintaining a trusted marketplace.
Adherence to our guiding principles and our focus on our mission and long-term sustainability may negatively influence
our financial performance. Further, our reputation could be harmed if we fail to meet our impact strategy goals.
We intend to operate in line with our guiding principles, focus on the long-term sustainability of our business, and work toward
our mission to “Keep Commerce Human.” We may take actions in line with our mission and guiding principles that we believe
will benefit our business and, therefore, our stockholders over a longer period of time, even if those actions do not maximize
short- or medium-term financial performance. However, these longer-term benefits may not materialize within the time frame
we expect or at all. For example:
• we may choose to prohibit the sale of items in our marketplace that are inconsistent with our policies even though we
could benefit financially from the sale of those items; or
33
• we may choose to revise our policies in ways that we believe will be beneficial to our community in the long term even
though the changes may be perceived unfavorably, such as updates to the way we define “handmade.”
Additionally, we have developed an impact strategy that focuses on leveraging Etsy’s core business to generate value for our
community and stakeholders through positive economic, social and environmental efforts. Our impact strategy aims to create
more economic opportunity for sellers, greater diversity in our workforce and build long-term resilience by reducing our carbon
footprint. If we don’t demonstrate progress against our impact strategy or if our impact strategy is not perceived to be adequate,
our reputation could be harmed.
Failure to deal effectively with fraud or other illegal activity could harm our business.
Although we have measures in place to detect and limit the occurrence of fraudulent and other illegal activity in our
marketplace, those measures may not always be effective.
For example, Etsy sellers occasionally receive orders placed with fraudulent or stolen credit card data. Under current credit
card chargeback rules, we could be held liable for orders placed through Etsy Payments with fraudulent credit card data even if
the associated financial institution approved the credit card transaction. Although we attempt to detect or challenge fraudulent
transactions, we may not be able to do so effectively. As a result, our business could be adversely affected. We could also incur
significant fines or lose our ability to give the option of paying with credit cards if we fail to follow payment card industry data
security standards or payment card association rules or fail to limit fraudulent transactions conducted in our marketplace.
We have adopted policies and procedures that are intended to ensure compliance with anti-corruption, anti-money laundering,
export controls, and trade sanctions requirements. In addition, as stated elsewhere in these Risk Factors, we rely upon third-
party service providers to perform certain underlying compliance, credit card processing identity verification, and fraud
analysis services. If we or our service providers do not perform adequately, certain of our fraud prevention and detection tools
may not be effective, which could lead to potential legal liability and negatively impact our business.
Negative publicity and sentiment resulting from fraudulent, illegal, or deceptive conduct by members of our community or the
perception that our levels of responsiveness and support for Etsy sellers and Etsy buyers are inadequate could reduce our ability
to attract and retain Etsy sellers and Etsy buyers and damage our reputation.
We are subject to risks related to our corporate social responsibility metrics.
We voluntarily report certain corporate social responsibility metrics. This transparency is consistent with our commitment to
executing on a strategy that reflects the positive economic, social, and environmental impact we want to have on the world
while advancing and complementing our business strategy. These metrics, whether it be the standards we set for ourselves and/
or our failure to meet such metrics, may influence our reputation and the value of our brand. For example, the perception held
by Etsy buyers or sellers, our partners or vendors, other key stakeholders, or the communities in which we do business may
depend, in part, on the metrics we have chosen to aspire to and whether or not we meet these metrics on a timely basis, if at all.
While selected metrics receive limited assurance from an independent third party, this is inherently a less rigorous process than
reasonable assurance sought in a typical auditing engagement. Our failure to achieve progress on our metrics on a timely basis,
or at all, could adversely affect our business, financial performance, or growth.
By electing to set and share publicly these corporate social responsibility metrics, our business may also face increased scrutiny
related to environmental, social, and governance activities. As a result, we could damage our reputation and the value of our
brand if we fail to act responsibly in the areas in which we report, such as economic security and personal empowerment,
diversity and inclusion, energy and water management, carbon footprint, and data privacy or if we are perceived not to have
rigorously measured our achievement against such metrics. Any harm to our reputation resulting from setting these metrics or
our failure or perceived failure to meet such metrics could impact: employee engagement and retention; the willingness of Etsy
buyers and sellers and our partners and vendors to do business with us; or investors willingness to purchase or hold shares of
our common stock, any of which could adversely affect our business, financial performance, and growth.
We face intense competition and may not be able to compete effectively.
Our industry is highly competitive and we expect competition to increase in the future. To be successful, we need to attract and
retain Etsy sellers and Etsy buyers. As a result, we face competition from a wide range of online and offline competitors.
We compete for Etsy sellers with both retailers and companies that sell software and services to small businesses. In addition to
listing her goods for sale on Etsy, an Etsy seller can list her goods with other online retailers, such as Amazon, eBay, or
Alibaba, or sell her goods through local consignment and vintage stores and other venues or marketplaces, including through
34
commerce channels on social networks like Facebook and Instagram. She may also sell wholesale directly to traditional
retailers, including large national retailers, who discover her goods in our marketplace or otherwise. We also compete with
companies that sell software and services to small businesses, enabling an Etsy seller to sell from her own website or otherwise
run her business independently of our platform, such as Bigcommerce, and Shopify.
We compete to attract, engage, and retain Etsy sellers based on many factors, including:
•
•
•
•
•
•
•
•
•
•
our brand awareness;
the extent to which our tools and services can ease the administrative tasks that an Etsy seller might encounter in running
her business;
the global scale of our marketplace and the breadth of our online presence;
the number and engagement of Etsy buyers;
our seller education resources and tools;
our policies and fees;
the ability to scale her business, including through Pattern or with a production partner;
our mobile apps;
the strength of our community; and
our mission.
In addition, we compete with retailers for the attention of the Etsy buyer. An Etsy buyer has the choice of shopping with any
online or offline retailer, including large e-commerce marketplaces, such as Amazon, eBay or Alibaba, national retail chains,
such as West Elm or Target, local consignment and vintage stores, social commerce channels like Instagram, event-driven
platforms and vertical experiences like Zola and Wayfair, and other venues or marketplaces. Many of these competitors offer
low-cost or free shipping, fast shipping times, favorable return policies, and other features that may be difficult or impossible
for Etsy sellers to match.
We compete to attract, engage, and retain Etsy buyers based on many factors, including:
•
•
•
•
•
•
•
•
•
•
the breadth of unique goods that Etsy sellers list in our marketplace;
the ease of finding the special item a buyer is looking for;
our brand awareness;
the person-to-person commerce experience;
customer service;
our reputation for trustworthiness;
our mobile apps;
the availability of fair and free shipping offered by Etsy sellers;
ease of payment; and
the availability and reliability of our platform.
Many of our competitors and potential competitors have longer operating histories, greater resources, better name recognition,
or more customers than we do.
They may invest more to develop and promote their services than we do, and they may offer lower fees to sellers than we do.
Additionally, we believe that it is relatively easy for new businesses to create online commerce offerings or tools or services
that enable entrepreneurship.
35
Local companies or more established companies based in markets where we operate outside of the United States may also have
a better understanding of local customs, providing them a competitive advantage. For example, in certain markets outside the
United States, we compete with smaller, but similar, local online marketplaces with a focus on unique goods that are attempting
to attract sellers and buyers in those markets.
If we are unable to compete successfully, or if competing successfully requires us to expend significant resources in response to
our competitors’ actions, our business could be adversely affected.
We rely on Etsy sellers to provide a fulfilling experience to Etsy buyers.
A small portion of Etsy buyers complain to us about their experience with our platform. For example, Etsy buyers may report
that they have not received the items that they purchased, that the items received were not as represented by an Etsy seller or
that an Etsy seller has not been responsive to their questions.
Negative publicity and sentiment generated as a result of these types of complaints could reduce our ability to attract and retain
Etsy sellers and Etsy buyers or damage our reputation. A perception that our levels of responsiveness and support for Etsy
sellers and Etsy buyers are inadequate could have similar results. In some situations, we may choose to reimburse Etsy buyers
for their purchases to help avoid harm to our reputation, but we may not be able to recover the funds we expend for those
reimbursements. Although we are focused on enhancing customer service, our efforts may be unsuccessful and Etsy sellers and
Etsy buyers may be disappointed in their Etsy experience and not return.
Anything that prevents the timely processing of orders or delivery of goods to Etsy buyers could harm Etsy sellers. Service
interruptions and delivery delays may be caused by events that are beyond the control of Etsy sellers, such as interruptions in
order or payment processing, transportation disruptions, natural disasters, inclement weather, terrorism, public health crises, or
political unrest. Disruptions in the operations of a substantial number of Etsy sellers could also result in negative experiences
for a substantial number of Etsy buyers, which could harm our reputation and adversely affect our business.
Our reputation may be harmed if members of our community use illegal or unethical business practices.
Our emphasis on our mission and guiding principles makes our reputation particularly sensitive to allegations of illegal or
unethical business practices by Etsy sellers or other members of our community. Our policies promote legal and ethical
business practices, such as encouraging Etsy sellers to work only with manufacturers who do not use child or involuntary labor,
who do not discriminate, and who promote sustainability and humane working conditions. However, we do not control Etsy
sellers or other members of our community or their business practices and cannot ensure that they comply with our policies. If
members of our community engage in illegal or unethical business practices or are perceived to do so, we may receive negative
publicity and our reputation may be harmed.
Our business depends on network and mobile infrastructure provided by third parties and on our ability to maintain
and scale the technology underlying our platform.
The reliability of our platform is important to our reputation and our ability to attract and retain Etsy sellers and Etsy buyers. As
the number of Etsy sellers and Etsy buyers, volume of traffic, number of transactions, and the amount of information shared on
our platform grow, our need for additional network capacity and computing power will also grow. The operation of the
technology underlying our platform is expensive and complex, and we could experience operational failures. If we fail to
accurately predict the rate or timing of the growth of our platform, we may be required to incur significant additional costs to
maintain reliability. The investments we make in our platform are designed to grow our business and to improve our operating
results in the long term, but these investments could also delay our ability to achieve profitability or reduce profitability in the
near term.
We also depend on the development and maintenance of the internet, cloud and mobile infrastructure, and increasingly rely on
the availability, features, cost, and reliability of third-party service providers and platforms. For example, this includes
maintenance of reliable internet and mobile networks with the necessary speed, data capacity, and security, as well as timely
development of complementary products.
Third-party providers host much of our technology infrastructure and are likely to host more in the future. Any disruption in
their services, or any failure of our providers to handle the demands of our marketplace could significantly harm our business.
We exercise little control over these providers, which increases our vulnerability to their financial conditions and to problems
with the services they provide, such as security concerns. Our efforts to update our infrastructure may not be successful or may
take longer than anticipated. If we experience failures in our technology infrastructure or do not expand our technology
36
infrastructure successfully, then our ability to attract and retain Etsy sellers and Etsy buyers could be adversely affected, which
could harm our growth prospects and our business.
We will rely on Google Cloud for a substantial portion of our computing, storage, data processing, networking, and
other services. Any disruption of or interference with our use of the Google Cloud operation would adversely affect our
business, financial performance, and growth.
Google Cloud Platform provides a distributed computing infrastructure as a service platform for business operations, and we
are in the process of migrating our data centers to Google Cloud, increasing our reliance on cloud infrastructure. As we
implement the transition to the cloud, there will be occasional planned or unplanned downtime for our websites and apps and
potential site delays, all of which will impact our sellers’ ability to conduct transactions and our buyers’ ability to
purchase items. We may also need to divert engineering resources away from other important business operations, which could
significantly harm our business and growth. Additionally, if the costs to migrate to Google Cloud are greater than we expect or
take significantly more time than we anticipate, our business could be harmed.
Any transition of the cloud services currently provided by Google Cloud to another cloud provider would be difficult to
implement and will cause us to incur significant time and expense. Any significant disruption of, or interference with, our use
of Google Cloud would negatively impact our operations and our business would be seriously harmed. In addition, if hosting
costs increase over time and if we require more computing or storage capacity, our costs could increase disproportionately. If
we are unable to grow our revenues faster than the cost of utilizing the services of Google or similar providers, our business
and financial condition could be adversely affected.
We may be subject to claims that items listed in our marketplace are counterfeit, infringing or illegal.
Although we do not create or take possession of the items listed in our marketplace by Etsy sellers, we frequently receive
communications alleging that items listed in our marketplace infringe third-party copyrights, trademarks, patents, or other
intellectual property rights. We have intellectual property complaint and take-down procedures in place to address these
communications, and we believe such procedures are important to promote confidence in our marketplace. We follow these
procedures to review complaints and relevant facts to determine the appropriate action, which may include removal of the item
from our marketplace and, in certain cases, closing the shops of Etsy sellers who repeatedly violate our policies.
Our procedures may not effectively reduce or eliminate our liability. In particular, we may be subject to civil or criminal
liability for activities carried out by Etsy sellers on our platform, especially outside the United States where laws may offer less
protection for intermediaries and platforms than the United States. Under current U.S. copyright law and the Communications
Decency Act, we may benefit from statutory safe harbor provisions that protect us from copyright liability for content posted on
our platform by Etsy sellers and Etsy buyers. However, trademark and patent laws do not include similar statutory provisions,
and liability for these forms of intellectual property is often determined by court decisions. These safe harbors and court rulings
may change unfavorably. In that event, we may be held secondarily liable for the intellectual property infringement of Etsy
sellers.
Regardless of the validity of any claims made against us, we may incur significant costs and efforts to defend against or settle
them. If a governmental authority determines that we have aided and abetted the infringement or sale of counterfeit goods or if
legal changes result in us potentially being liable for actions by Etsy sellers on our platform, we could face regulatory, civil, or
criminal penalties. Successful claims by third-party rights owners could require us to pay substantial damages or refrain from
permitting any further listing of the relevant items. These types of claims could force us to modify our business practices,
which could lower our revenue, increase our costs or make our platform less user-friendly. Moreover, public perception that
counterfeit or other unauthorized items are common in our marketplace, even if factually incorrect, could result in negative
publicity and damage to our reputation.
Our business and our Etsy sellers and Etsy buyers may be subject to sales and other taxes.
The application of indirect taxes, such as sales and use tax, value-added tax, provincial taxes, goods and services tax, business
tax, withholding tax, digital service tax, and gross receipt tax, to businesses like ours and to Etsy sellers and Etsy buyers is a
complex and evolving issue. Significant judgment is required to evaluate applicable tax obligations and as a result amounts
recorded are estimates and are subject to adjustments. In many cases, the ultimate tax determination is uncertain because it is
not clear when and how new and existing statutes might apply to our business or to Etsy sellers’ businesses. If Etsy is found to
be deficient in how it has addressed its tax obligations, our business could be adversely impacted.
37
One or more states, the federal government, or other countries are seeking to, or have recently imposed additional reporting,
record-keeping, or indirect tax collection and remittance obligations on businesses like ours that facilitate online commerce. If
requirements like these become applicable in additional jurisdictions, our business could be harmed. For example, taxing
authorities in certain U.S. states and in other countries have identified e-commerce platforms as a means to calculate, collect,
and remit indirect taxes for transactions taking place over the internet, and are considering related legislation. Additionally, the
Supreme Court’s recent decision in South Dakota v. Wayfair, Inc. et al overturned existing law that sellers are not required to
collect sales and use tax unless they have a physical presence in the buyer’s state. As a result of the Wayfair decision, states or
the federal government may adopt, or begin to enforce laws requiring Etsy sellers to calculate, collect, and remit taxes on their
sales. Such changes to current law or new legislation could adversely affect our business if the requirement of tax to be charged
on items sold on Etsy causes our marketplace to be less attractive to current and prospective Etsy buyers, which could
materially impact our business, financial performance, and growth. Additionally, new legislation could require us or Etsy sellers
to incur substantial costs in order to comply, including costs associated with tax calculation, collection, remittance, and audit
requirements, which could make selling in our marketplace less attractive.
Our business is subject to a large number of U.S. and non-U.S. laws, many of which are evolving.
We are subject to a variety of laws and regulations in the United States and around the world, including those relating to
traditional businesses, such as employment laws and taxation, and laws and regulations focused on ecommerce and online
marketplaces, such as online payments, privacy, anti-spam, data security and protection, online platform liability, intellectual
property, and consumer protection. In light of our international operations, we need to comply with various laws associated
with doing business outside of the United States, including anti-money laundering, sanctions, anti-corruption, and export
control laws. In some cases, non-U.S. privacy, data security, consumer protection, e-commerce, and other laws and regulations
are more detailed than those in the United States and, in some countries, are actively enforced.
These laws and regulations are continuously evolving, and compliance is costly and can require changes to our business
practices and significant management time and effort.
Additionally, it is not always clear how existing laws apply to online marketplaces as many of these laws do not address the
unique issues raised by online marketplaces or ecommerce. For example, as described elsewhere in these Risk Factors, laws
relating to privacy are evolving differently in different jurisdictions. Federal, state, and non-U.S. governmental authorities, as
well as courts interpreting the laws, continue to evaluate and assess the privacy requirements that are applicable to Etsy.
Some providers of consumer devices and web browsers have implemented, or have announced plans to implement, ways to
block tracking technologies which, if widely adopted, could also result in online tracking methods becoming significantly less
effective. Any reduction in our ability to make effective use of such technologies could harm our ability to personalize the
experience of Etsy buyers, increase our costs and limit our ability to attract and retain Etsy sellers and Etsy buyers on cost-
effective terms. As a result, our business could be adversely affected.
Existing and future laws and regulations enacted by federal, state, or non-U.S. governments or the inconsistent enforcement of
such laws and regulations could impede the growth of ecommerce or online marketplaces, which could have a negative impact
on our business and operations. Examples include data localization requirements, limitation on marketplace scope or
ownership, intellectual property intermediary liability rules, regulation of online speech, limits on network neutrality, and rules
related to security, privacy, or national security, which may impede Etsy or our users. We could also face regulatory challenges
or be subject to discriminatory or anti-competitive practices that could impede both our and Etsy sellers’ growth prospects,
increase our costs, and harm our business.
We strive to comply with all applicable laws, but they may conflict with each other, and by complying with the laws or
regulations of one jurisdiction, we may find that we are violating the laws or regulations of another jurisdiction. Despite our
efforts, we may not have fully complied in the past and may not in the future. If we become liable under laws or regulations
applicable to us, we could be required to pay significant fines and penalties, our reputation may be harmed and we may be
forced to change the way we operate. That could require us to incur significant expenses or to discontinue certain services,
which could negatively affect our business.
Additionally, if third parties with whom we work violate applicable laws or our policies, those violations could result in other
liabilities for us and could harm our business. Furthermore, the circumstances in which we may be held liable for the acts,
omissions or responsibilities of our sellers is uncertain, complex, and evolving. For example, certain laws have recently been
enacted seeking to hold marketplaces like ours responsible for certain compliance obligations for which sellers have
traditionally been responsible. If an increasing number of such laws are passed, the resulting compliance costs and potential
liability risk could negatively impact our business.
38
Our software is highly complex and may contain undetected errors.
The software underlying our platform is highly interconnected and complex and may contain undetected errors or
vulnerabilities, some of which may only be discovered after the code has been released. We rely heavily on a software
engineering practice known as “continuous deployment,” meaning that we typically release software code many times per day.
This practice may result in the more frequent introduction of errors or vulnerabilities into the software underlying our platform,
which can impact the user experience on Etsy.com. Additionally, due to the interconnected nature of the software underlying
our platform, updates to certain parts of our code, including changes to Etsy or third party APIs on which Etsy relies, could
have an unintended impact on other sections of our code, which may result in errors or vulnerabilities to our platform that
negatively impact the user experience and functionality of our marketplace. Any errors or vulnerabilities discovered in our code
after release could result in damage to our reputation, loss of our community members, loss of revenue or liability for damages,
any of which could adversely affect our growth prospects and our business.
Our business depends on continued and unimpeded access to the internet and mobile networks.
Etsy sellers and Etsy buyers rely on access to the internet or mobile networks to access our marketplace. Internet service
providers may choose to disrupt or degrade access to our platform or increase the cost of such access. Mobile network
operators or operating system providers could block or place onerous restrictions on the ability to download and use our mobile
apps.
Internet service providers or mobile network operators could also attempt to charge us for providing access to our platform. In
addition, we could face discriminatory or anticompetitive practices that could impede both our and Etsy sellers’ growth
prospects, increase our costs, and harm our business. In 2015, rules approved by the Federal Communications Commission
(“FCC”) went into effect that prohibited internet service providers from charging content providers higher rates in order to
deliver their content over certain “fast traffic” lanes; however, those rules were repealed in June 2018. This repeal may make it
more difficult or costly for many small businesses such as our community of sellers, as well as our buyers, to access our
platform and may result in increased costs for us, which could significantly harm our business, and the millions of
microbusinesses that utilize our platform. We, along with other companies and public interest groups, are challenging this
repeal in the courts, but these efforts may not be successful and may be costly.
Outside of the United States, it is possible that governments of one or more countries may seek to censor content available on
our platform or may even attempt to block access to our platform. If we are restricted from operating in one or more countries,
our ability to attract and retain Etsy sellers and Etsy buyers may be adversely affected and we may not be able to grow our
business as we anticipate.
Our business could be negatively affected as a result of actions of activist stockholders.
The actions of activist stockholders could adversely affect our business. Specifically, responding to common actions of an
activist stockholder, such as requests for special meetings, potential nominations of candidates for election to our Board of
Directors, requests to pursue a strategic combination, or other transaction or other special requests, could disrupt our
operations, be costly and time-consuming, or divert the attention of our management and employees. In addition, perceived
uncertainties as to our future direction in relation to the actions of an activist stockholder may result in the loss of potential
business opportunities or the perception that we are unstable as a company, which may make it more difficult to attract and
retain qualified employees. Actions of an activist stockholder may also cause fluctuations in our stock price based on
speculative market perceptions or other factors that do not necessarily reflect the underlying fundamentals and prospects of our
business.
We may be subject to intellectual property claims, which are extremely costly to defend, could require us to pay
significant damages, and could limit our ability to use certain technologies in the future.
Companies in the internet and technology industries are frequently subject to litigation based on allegations of infringement or
other violations of intellectual property rights. We periodically receive communications that claim we have infringed,
misappropriated, or misused others’ intellectual property rights. To the extent we gain greater public recognition, we may face a
higher risk of being the subject of intellectual property claims. Third-parties may have intellectual property rights that cover
significant aspects of our technologies or business methods and prevent us from expanding our offerings. Third parties may
also allege a company is secondarily liable for intellectual property infringement, or that it is a joint infringer with another
party. Any intellectual property claim against us, with or without merit, could be time consuming and expensive to settle or
litigate and could divert the attention of our management. Litigation regarding intellectual property rights is inherently
uncertain due to the complex issues involved, and we may not be successful in defending ourselves in such matters. In addition,
39
some of our competitors have extensive portfolios of issued patents. Many potential litigants, including some of our
competitors and patent holding companies, have the ability to dedicate substantial resources to enforcing their intellectual
property rights. Any claims successfully brought against us could subject us to significant liability for damages and we may be
required to stop using technology or other intellectual property alleged to be in violation of a third party’s rights in one or more
jurisdictions where Etsy does business. We also might be required to seek a license for third-party intellectual property. Even if
a license is available, we could be required to pay significant royalties or submit to unreasonable terms, which would increase
our operating expenses. We may also be required to develop alternative non-infringing technology, which could require
significant time and expense. If we cannot license or develop technology for any allegedly infringing aspect of our business, we
would be forced to limit our service and may be unable to compete effectively. Any of these results could harm our business.
We may be unable to protect our intellectual property adequately.
Our intellectual property is an essential asset of our business. To establish and protect our intellectual property rights, we rely
on a combination of trade secret, copyright, trademark, and patent laws, as well as confidentiality procedures and contractual
provisions. The efforts we have taken to protect our intellectual property may not be sufficient or effective. We generally do not
elect to register our copyrights, relying instead on the laws protecting unregistered intellectual property, which may not be
sufficient. We rely on both registered and unregistered trademarks, which may not always be comprehensive in scope. In
addition, our copyrights and trademarks, whether or not registered, and patents may be held invalid or unenforceable if
challenged, and may be of limited territorial reach. While we have obtained or applied for patent protection with respect to
some of our intellectual property, we generally do not rely on patents as a principal means of protecting intellectual property. To
the extent we do seek patent protection, any U.S. or other patents issued to us may not be sufficiently broad to protect our
proprietary technologies.
In addition, we may not be effective in policing unauthorized use of our intellectual property and authorized uses may not have
the intended effect. Even if we do detect violations, we may need to engage in litigation to enforce our intellectual property
rights. Any enforcement efforts we undertake, including litigation, could be time-consuming and expensive and could divert
our management’s attention. In addition, our efforts may be met with defenses and counterclaims challenging the validity and
enforceability of our intellectual property rights or may result in a court determining that our intellectual property rights are
unenforceable. The legal framework surrounding protection of intellectual property changes frequently throughout the world,
and these changes may impact our ability to protect our intellectual property and defend against third party claims. If we are
unable to cost-effectively protect our intellectual property rights, then our business could be harmed.
We are subject to the terms of open source licenses because our platform incorporates open source software.
The software powering our marketplace incorporates software covered by open source licenses. In addition, we regularly
contribute source code to open source software projects and release internal software projects under open source licenses, and
we anticipate doing so in the future. The terms of many open source licenses relied upon by Etsy and the internet and
technology industries have been interpreted by only a few court decisions and there is a risk that the licenses could be construed
in a manner that imposes unanticipated conditions or restrictions on our ability to operate our marketplace. Under certain open
source licenses, if certain conditions were met, we could be required to publicly release aspects of the source code of our
software or to make our software available under open source licenses. To avoid the public release of the affected portions of
our source code, we could be required to expend substantial time and resources to re-engineer some or all of our software. In
addition, use of open source software can lead to greater risks than use of third-party commercial software because open source
licensors generally do not provide warranties or controls on the origin of the software. Use of open source software may also
present additional security risks because the public availability of such software may make it easier for hackers and other third
parties to determine how to compromise our platform. Additionally, because any software source code we contribute to open
source projects is publicly available, while we may benefit from the contributions of others, our ability to protect our
intellectual property rights in such software source code may be limited or lost entirely, and we will be unable to prevent our
competitors or others from using such contributed software source code. Any of these risks could be difficult to eliminate or
manage and, if not addressed, could adversely affect our business, financial performance and growth.
We may experience fluctuations in our tax obligations and effective tax rate.
We are subject to taxation in the United States and in numerous other jurisdictions. We record tax expense based on current tax
payments and our estimates of future tax payments, which may include reserves for estimates of probable settlements of tax
audits. At any one time, multiple tax years could be subject to audit by various taxing jurisdictions. As a result, we could be
subject to higher than anticipated tax liabilities as well as ongoing variability in our quarterly tax rates as audits close and
exposures are re-evaluated. Further, our effective tax rate in a given financial statement period may be adversely impacted by
40
changes in tax laws, changes in the mix of revenue among different jurisdictions, changes to accounting rules, and changes to
our ownership or capital structure. Fluctuations in our tax obligations and effective tax rate could adversely affect our business.
In December 2017, the U.S. government enacted comprehensive tax legislation that includes significant changes to the taxation
of business entities. These changes include, among others, (1) a permanent reduction to the corporate income tax rate, (2) a
partial limitation on the deductibility of business interest expense, (3) a shift of the U.S. taxation of multinational corporations
from a tax on worldwide income to a quasi-territorial system (along with certain rules designed to prevent erosion of the U.S.
income tax base), and (4) a one-time tax on accumulated offshore earnings held in cash and illiquid assets, with the latter taxed
at a lower rate. Notwithstanding the reduction in the corporate income tax rate, the overall impact of this tax reform is
uncertain, and our business and financial condition could be adversely affected.
In January 2015, we implemented a revised corporate structure to more closely align our structure with our global operations
and future expansion plans outside of the United States. Our new corporate structure changed how we use our intellectual
property and implemented certain intercompany arrangements. We believe this may result in a reduction in our overall effective
tax rate over the long term and other operational efficiencies; however, the tax laws of the jurisdictions in which we operate are
subject to interpretation, and their application may depend on our ability to operate our business in a manner consistent with
our corporate structure. Moreover, these tax laws are subject to change. Tax authorities may disagree with our position as to the
tax treatment of our transfer of intangible assets or determine that the manner in which we operate our business does not
achieve the intended tax consequences. If our new corporate structure does not achieve our expectations for any of these or
other reasons, we may be subject to a higher overall effective tax rate and our business may be adversely affected.
We may be involved in litigation matters that are expensive and time consuming.
In addition to intellectual property claims, we may become involved in other litigation matters, including class action lawsuits.
For example, as described further in “Note 14—Commitments and Contingencies—Legal Proceedings” in the Notes to
Consolidated Financial Statements, a purported securities class action lawsuit was recently dismissed that named Etsy and
certain of our officers and/or directors as defendants. Under certain circumstances, we have contractual and other legal
obligations to indemnify and to incur legal expenses on behalf of current and former directors, officers, and underwriters. Any
lawsuit to which we are a party, with or without merit, may result in an unfavorable judgment. We also may decide to settle
lawsuits on unfavorable terms. Any such negative outcome could result in payments of substantial damages or fines, damage to
our reputation, or adverse changes to our offerings or business practices. Any of these results could adversely affect our
business. In addition, defending claims is costly and can impose a significant burden on our management.
We may expand our business through acquisitions of other businesses, which may divert management’s attention and/or
prove to be unsuccessful.
We have acquired a number of other businesses in the past and may acquire additional businesses or technologies in the future.
Acquisitions may divert management’s time and focus from operating our business. Acquisitions also may require us to spend a
substantial portion of our available cash, issue stock, incur debt or other liabilities, amortize expenses related to intangible
assets, or incur write-offs of goodwill or other assets. In addition, integrating an acquired business or technology is risky.
Completed and future acquisitions may result in unforeseen operational difficulties and expenditures associated with:
•
•
•
integrating new businesses and technologies into our infrastructure;
consolidating operational and administrative functions;
coordinating outreach to our community;
• maintaining morale and culture and retaining and integrating key employees;
• maintaining or developing controls, procedures and policies (including effective internal control over financial reporting
and disclosure controls and procedures); and
•
assuming liabilities related to the activities of the acquired business before and after the acquisition, including liabilities for
violations of laws and regulations, commercial disputes, cyber attacks, taxes, and other matters.
Moreover, we may not benefit from our acquisitions as we expect, or in the time frame we expect. We also may issue additional
equity securities in connection with an acquisition, which could cause dilution to our stockholders. Finally, acquisitions could
be viewed negatively by analysts, investors or the members of our community.
41
If our insurance coverage is insufficient or our insurers are unable to meet their obligations, our insurance may not
mitigate the risks facing our business.
Our insurance policies cover a number of risks and potential liabilities, such as general liability, property coverage, errors, and
omissions liability, employment liability, business interruptions, data breaches, crime, product liability, and directors’ and
officers’ liability. For certain types of business risk, we may not be able to, or may choose not to, acquire insurance. In addition,
our insurance may not adequately mitigate the risks we face or we may have to pay high premiums and/or deductibles for the
coverage we do obtain. Additionally, if any of our insurers becomes insolvent, it would be unable to pay any claims that we
make.
The growth of our business may strain our management team and our operational and financial infrastructure.
We have experienced rapid growth in our business, in the number of Etsy sellers and the number of countries in which we have
Etsy sellers and Etsy buyers, and we plan to continue to grow in the future, both in the United States and abroad. The growth of
our business places significant demands on our management team and pressure to expand our operational and financial
infrastructure. For example, we may need to continue to develop and improve our operational, financial, and management
controls and enhance our reporting systems and procedures. If we do not manage our growth effectively, the increases in our
operating expenses could outpace any increases in our revenue and our business could be harmed.
Operating as a public company requires us to incur substantial costs and requires substantial management attention.
As a public company, we incur substantial legal, accounting, and other expenses that we did not incur as a private company. For
example, we are subject to the reporting requirements of the Exchange Act, the applicable requirements of the Sarbanes-Oxley
Act of 2002, (“the Sarbanes-Oxley Act”), and the Dodd-Frank Wall Street Reform and Consumer Protection Act and the rules
and regulations of the Securities and Exchange Commission (“SEC”). The rules and regulations of the Nasdaq Global Select
Market (“Nasdaq”) also apply to us. As part of these requirements, we have established and maintained effective disclosure and
financial controls and made changes to our corporate governance practices. Continued compliance with these requirements may
increase our legal and financial compliance costs in the future and may make some activities more time-consuming. In
addition, as described elsewhere in these Risk Factors, as a public company, we may be subject to stockholder activism, which
can lead to additional substantial costs, distract management, and impact the manner in which we operate our business in ways
we cannot currently anticipate.
If we are unable to maintain effective internal control over financial reporting, investors may lose confidence in the
accuracy of our financial reports.
As a public company, we are required to maintain internal control over financial reporting and to report any material
weaknesses in such internal controls. Section 404 of the Sarbanes-Oxley Act requires that we evaluate and determine the
effectiveness of our internal control over financial reporting. It also requires our independent registered public accounting firm
to attest to our evaluation of our internal controls over financial reporting. Although our management has determined, and our
independent registered public accounting firm has attested, that our internal control over financial reporting was effective as of
December 31, 2018, we cannot assure you that we or our independent registered public accounting firm will not identify a
material weakness in our internal control in the future.
If we have a material weakness in our internal control over financial reporting in the future, we may not detect errors on a
timely basis. If we are not able to comply with the requirements of Section 404 of the Sarbanes-Oxley Act, or if we identify a
material weakness in our internal control over financial reporting in the future, it could harm our operating results, cause us to
fail to meet our SEC reporting obligations or Nasdaq listing requirements, adversely affect our reputation, cause our stock price
to decline, or result in inaccurate financial reporting or material misstatements in our annual or interim financial statements.
Further, if there are material weaknesses or failures in our ability to meet any of the requirements related to the maintenance
and reporting of our internal controls, such as Section 404 of the Sarbanes-Oxley Act, investors may lose confidence in the
accuracy and completeness of our financial reports and that could cause the price of our common stock to decline. We could
become subject to investigations by Nasdaq, the SEC or other regulatory authorities, which could require additional
management attention and which could adversely affect our business.
In addition, our internal control over financial reporting will not prevent or detect all errors and fraud. Because of the inherent
limitations in all control systems, no evaluation of controls can provide absolute assurance that misstatements due to error or
fraud will not occur or that all control issues and instances of fraud will be detected.
42
We have a significant amount of debt and may incur additional debt in the future. We may not have sufficient cash flow
from our business to pay our substantial debt when due.
Our ability to pay our debt when due or to refinance our indebtedness, including the 0% Convertible Senior Notes due 2023 we
issued in March 2018, (the “Notes”), depends on our future performance, which is subject to economic, financial, competitive,
and other factors beyond our control. Our business may not continue to generate cash flow from operations in the future
sufficient to service our debt and make necessary capital expenditures. In addition, any required repurchase of the Notes for
cash as a result of a fundamental change would lower our current cash on hand such that we would not have those funds
available for us in our business. If we are unable to generate such cash flow, we may be required to adopt one or more
alternatives, such as selling assets, restructuring debt or obtaining additional equity capital on terms that may be onerous or
highly dilutive. Our ability to refinance our indebtedness will depend on the capital markets and our financial condition at such
time. We may not be able to engage in any of these activities or engage in these activities on desirable terms, which could result
in a default on our debt obligations.
In addition, we and our subsidiaries may be able to incur substantial additional debt in the future, subject to the restrictions
contained in our debt instruments, some of which may be secured debt. If, for example, we incur additional debt, secure
existing or future debt or recapitalize our debt, these actions may diminish our ability to make payments on our substantial debt
when due.
The accounting method for convertible debt securities that may be settled in cash, such as the Notes, could have a
material effect on our reported financial results.
In May 2008, the Financial Accounting Standards Board (“FASB”) issued FASB Staff Position No. APB 14-1, Accounting for
Convertible Debt Instruments That May Be Settled in Cash Upon Conversion (Including Partial Cash Settlement), which has
subsequently been codified as Accounting Standards Codification 470-20—Debt with Conversion and Other Options, (“ASC
470-20”). Under ASC 470-20, an entity must separately account for the liability and equity components of the convertible debt
instruments (such as the Notes) that may be settled entirely or partially in cash upon conversion in a manner that reflects the
issuer’s economic interest cost. The effect of ASC 470-20 on the accounting for the Notes is that the equity component is
required to be included in the additional paid-in capital section of stockholders’ equity on our Consolidated Balance Sheet, and
the value of the equity component would be treated as original issue discount for purposes of accounting for the debt
component of the Notes. As a result, we will be required to record a greater amount of non-cash interest expense in current
periods presented as a result of the amortization of the discounted carrying value of the Notes to their face amount over the
term of the Notes. We will report lower net income in our financial results because ASC 470-20 will require interest to include
both the current period’s amortization of the debt discount and the instrument’s coupon interest, which could adversely affect
our reported or future financial results, the trading price of our common stock and the trading price of the Notes.
In addition, under certain circumstances, convertible debt instruments (such as the Notes) that may be settled entirely or partly
in cash are currently accounted for utilizing the treasury stock method, the effect of which is that the shares issuable upon
conversion of the Notes are not included in the calculation of diluted earnings per share except to the extent that the conversion
value of the Notes exceeds their principal amount. Under the treasury stock method, for diluted earnings per share purposes, the
transaction is accounted for as if the number of shares of common stock that would be necessary to settle such excess, if we
elected to settle such excess in shares, are issued. We cannot be sure that the accounting standards in the future will continue to
permit the use of the treasury stock method. If we are unable to use the treasury stock method in accounting for the shares
issuable upon conversion of the Notes, then our diluted earnings per share would be adversely affected.
The terms of our debt instruments may restrict our ability to pursue our business strategies.
We do not currently have any obligations outstanding under our credit facility. However, our credit facility requires us to
comply with various covenants that limit our ability to take actions such as:
•
•
•
•
•
disposing of assets;
completing mergers or acquisitions;
incurring additional indebtedness;
encumbering our properties or assets;
paying dividends or making other distributions;
43
• making specified investments; and
•
engaging in transactions with our affiliates.
These restrictions could limit our ability to pursue our business strategies. If we default under our credit facility and if the
default is not cured or waived, the lenders could terminate their commitments to lend to us and cause any amounts outstanding
to be payable immediately. Such a default could also result in cross defaults under other debt instruments. Moreover, any such
default would limit our ability to obtain additional financing, which may have an adverse effect on our cash flow and liquidity.
We may need additional capital, which may not be available to us on acceptable terms or at all.
We believe that our existing cash and cash equivalents and short-term investments, together with cash generated from
operations will be enough to meet our anticipated cash needs for at least the next 12 months. However, we may require
additional cash resources due to changes in business conditions or other developments, such as acquisitions or investments we
may decide to pursue. We may seek to borrow funds under our credit facility or sell additional equity or debt securities. The
sale of additional equity or convertible debt securities could result in dilution to our existing stockholders. Any debt financing
that we may secure in the future could result in additional operating and financial covenants that would limit or restrict our
ability to take certain actions, such as incurring additional debt, making capital expenditures or declaring dividends. It is also
possible that financing may not be available to us in amounts or on terms acceptable to us, if at all.
Risks Related to Ownership of Our Common Stock
The price of our common stock has been and will likely continue to be volatile and declines in the price of common stock
could subject us to litigation.
The price of our common stock has been and is likely to continue to be volatile. For example, since January 1, 2018, our
common stock’s daily closing price on Nasdaq has ranged from a low of $17.73 to a high of $57.43 through February 21, 2019.
The price of our common stock may fluctuate significantly for numerous reasons, many of which are beyond our control, such
as:
•
•
•
•
•
•
•
•
•
•
•
variations in our operating results and other financial and operational metrics, including the key financial and operating
metrics disclosed in this Annual Report, as well as how those results and metrics compare to analyst and investor
expectations;
forward-looking statements related to our financial guidance or projections, our failure to meet or exceed our financial
guidance or projections or changes in our financial guidance or projections;
failure of analysts to initiate or maintain coverage of our company, changes in their estimates of our operating results or
changes in recommendations by analysts that follow our common stock or a negative view of our financial guidance or
projections and our failure to meet or exceed the estimates of such analysts;
announcements of new services or enhancements, strategic alliances or significant agreements or other developments by
us or our competitors;
announcements by us or our competitors of mergers or acquisitions or rumors of such transactions involving us or our
competitors;
the amount and timing of our operating expenses and the success of any cost-savings actions we take;
changes in our Board of Directors or senior management team;
disruptions in our marketplace due to hardware, software or network problems, security breaches, or other issues;
the strength of the global economy or the economy in the jurisdictions in which we operate, currency fluctuations, and
market conditions in our industry and those affecting members of our community;
the trading activity of our largest stockholders;
the number of shares of our common stock that are available for public trading;
44
•
•
•
•
•
•
litigation or other claims against us;
stockholder activism;
the performance of the equity markets in general and in our industry;
the operating performance of other similar companies;
changes in legal requirements relating to our business; and
any other factors discussed in this Annual Report.
In addition, if the market for technology stocks or the stock market in general experiences a loss of investor confidence, the
price of our common stock could decline for reasons unrelated to our business, financial performance, or growth. Stock prices
of many internet and technology companies have historically been highly volatile. Some companies that have experienced
volatility in the trading price of their stock have been the subject of securities class action litigation. We have experienced
securities class action lawsuits in the past and may experience more such litigation following future periods of volatility or
declines in our stock price. Any securities litigation, could result in substantial costs and divert our management’s attention and
resources, which could adversely affect our business.
If analysts do not publish research about our business, or if they publish inaccurate or unfavorable research, our stock
price and trading volume could decline.
The trading market for our common stock depends in part on the research and reports that analysts publish about our business.
We do not have any control over these analysts. If one or more of the analysts who cover us downgrade our common stock or
publish inaccurate or unfavorable research about our business, the price of our common stock would likely decline. If few
analysts cover us, demand for our common stock could decrease and our common stock price and trading volume may decline.
Similar results may occur if one or more of these analysts stop covering us in the future or fail to publish reports on us
regularly.
Our stock repurchases may not achieve the desired objectives.
In November 2018, our Board of Directors approved a stock repurchase program authorizing us to repurchase up to $200
million of our common stock. Previously, in November 2017, our Board of Directors approved a stock repurchase program
authorizing us to repurchase up to $100 million of our common stock, which we completed in the second quarter of 2018.
There can be no assurance that these stock repurchases will enhance stockholder value because the market price of our common
stock may decline below the levels at which we repurchased such shares. In addition, there is no guarantee that our stock
repurchases in the past or in the future will be able to successfully mitigate the dilutive effect of recent and future employee
stock option exercises and restricted stock vesting.
We do not intend to pay dividends on our capital stock, so any returns will be limited to increases in the value of our
common stock.
We have never declared or paid any cash dividends on our capital stock. We currently anticipate that we will retain future
earnings for the operation and expansion of our business and do not anticipate declaring any dividends in the foreseeable
future. In addition, our ability to pay cash dividends on our capital stock is restricted by the terms of our credit facility. As a
result, stockholders will not receive dividends or other distributions and may only receive a return on their investment if the
trading price of our common stock increases.
Future sales and issuances of our common stock or rights to purchase common stock could result in additional dilution
to our stockholders and could cause the price of our common stock to decline.
We may issue additional common stock, convertible securities, or other equity in the future. We also issue common stock to our
employees, directors, and other service providers pursuant to our equity incentive plans. Such issuances could be dilutive to
investors and could cause the price of our common stock to decline. New investors in such issuances could also receive rights
senior to those of current stockholders.
45
Anti-takeover provisions in our charter documents and under Delaware law could make an acquisition of our company
more difficult, could limit attempts to make changes in our management and could depress the price of our common
stock.
Provisions in our certificate of incorporation and bylaws may have the effect of delaying or preventing a change in control of
our company or limiting changes in our management. Among other things, these provisions:
•
•
•
•
•
•
•
•
•
•
provide for a classified board of directors so that not all members of our Board of Directors are elected at one time;
permit our Board of Directors to establish the number of directors and fill any vacancies and newly created directorships;
provide that directors may only be removed for cause;
require super-majority voting to amend some provisions in our certificate of incorporation and bylaws;
authorize the issuance of “blank check” preferred stock that our Board of Directors could use to implement a stockholder
rights plan;
eliminate the ability of our stockholders to call special meetings of stockholders;
prohibit stockholder action by written consent, which means all stockholder actions must be taken at a meeting of our
stockholders;
provide that our Board of Directors is expressly authorized to amend or repeal any provision of our bylaws;
restrict the forum for certain litigation against us to Delaware; and
require advance notice for nominations for election to our Board of Directors or for proposing matters that can be acted
upon by stockholders at annual stockholder meetings.
These provisions may delay or prevent attempts by our stockholders to replace members of our management by making it more
difficult for stockholders to replace members of our Board of Directors, which is responsible for appointing the members of our
management. In addition, Section 203 of the Delaware General Corporation Law (“DGCL”) may delay or prevent a change in
control of our company. Section 203 of the DGCL imposes certain restrictions on mergers, business combinations and other
transactions between us and holders of 15% or more of our common stock. Anti-takeover provisions could depress the price of
our common stock by acting to delay or prevent a change in control of our company.
Our certificate of incorporation provides that the Court of Chancery of the State of Delaware is the exclusive forum for
substantially all disputes between us and our stockholders, which could limit our stockholders’ ability to obtain a
favorable judicial forum for disputes with us or our directors, officers or employees.
Our certificate of incorporation provides that the Court of Chancery of the State of Delaware is the exclusive forum for any
derivative action or proceeding brought on our behalf, any action asserting a breach of fiduciary duty, any action asserting a
claim against us arising pursuant to the DGCL, our certificate of incorporation or our bylaws or any action asserting a claim
against us that is governed by the internal affairs doctrine. This choice of forum provision may limit a stockholder’s ability to
bring a claim in a judicial forum that it finds favorable for disputes with us or our directors, officers or other employees and
may discourage these types of lawsuits. Alternatively, if a court were to find the choice of forum provision contained in our
certificate of incorporation to be inapplicable or unenforceable in an action, we may incur additional costs associated with
resolving such action in other jurisdictions.
46
Item 1B. Unresolved Staff Comments.
None.
Item 2. Properties.
Our headquarters are located in Brooklyn, New York where we occupy approximately 198,635 square feet under a lease that
expires in 2026. We use these facilities for our principal administration, technology and development and engineering activities.
Our European headquarters are located in Dublin, Ireland.
We believe that our current facilities are suitable and adequate to meet our ongoing needs and that, if we require additional
space, we will be able to obtain additional facilities.
Item 3. Legal Proceedings.
See “Note 14—Commitments and Contingencies—Legal Proceedings” in the Notes to Consolidated Financial Statements.
Item 4. Mine Safety Disclosures.
Not applicable.
47
PART II.
Item 5. Market for Registrant’s Common Equity, Related Stockholder Matters and Issuer Purchases of Equity
Securities.
Market for Etsy’s Common Stock
Our common stock has been listed on the Nasdaq Global Select Market under the symbol “ETSY” since April 16, 2015. Prior
to that date, there was no public trading market for our common stock.
Holders of Record
As of the close of business on February 21, 2019, there were approximately 168 stockholders of record of our common stock.
The number of stockholders of record is based upon the actual number of holders registered on this date and does not include
holders of common stock in “street name” by brokers or other entities on behalf of stockholders.
Dividend Policy
We have never declared or paid cash dividends on our capital stock. We intend to retain all available funds and future earnings
and do not anticipate paying cash dividends in the foreseeable future. Any future decision to declare cash dividends will be
made at the discretion of our Board of Directors, subject to applicable laws and will depend on a number of factors, including
our financial condition, results of operations, capital requirements, contractual restrictions, general business conditions, and
other factors that our Board of Directors thinks are relevant.
Unregistered Sales of Equity Securities
On September 19, 2016, we issued 685,749 shares of our common stock to the former stockholders of Blackbird Technologies,
Inc. (“Blackbird”), a machine learning company, in connection with the acquisition of Blackbird. This transaction was exempt
from registration under the Securities Act pursuant to Section 4(a)(2) of the Securities Act and Regulation D.
On May 5, 2016, we issued and sold an aggregate of 80,011 shares of our common stock upon the net exercise of warrants to
purchase 97,931 shares of our common stock. The shares of common stock were issued pursuant to Section 3(a)(9) of the
Securities Act.
Issuer Purchases of Equity Securities
The table below provides information with respect to repurchases of shares of our common stock during the three months
ended December 31, 2018:
Period
October 1 - 31, 2018 (1)
November 1 - 30, 2018
December 1 - 31, 2018
Total
Total Number of
Shares Purchased
Average Price Paid
per Share(2)
138,695
$
676,955
239,128
1,054,778
$
49.96
47.27
54.37
49.23
Total Number of
Shares Purchased as
Part of Publicly
Announced Plans or
Programs(3)(4)
Approximate Dollar
Value of Shares that
May Yet be Purchased
under the Plans or
Programs
(in thousands)(3)
— $
676,955
239,128
916,083
$
—
168,000
155,000
155,000
(1) The total number of shares purchased includes 138,695 shares withheld to satisfy tax withholding obligations in
connection with the vesting of employee restricted stock units (“RSUs”).
(2) Average price paid per share excludes broker commissions.
(3) On November 6, 2018, we announced that our Board of Directors had approved a stock repurchase program for the
repurchase of up to $200 million of our common stock. The stock repurchase program has no expiration date.
(4) A portion of these shares were purchased pursuant to a 10b5-1 trading plan.
48
Performance Graph
The following graph shows a comparison from April 16, 2015 (the date our common stock commenced trading on Nasdaq)
through December 31, 2018, of the cumulative total returns for our common stock, the Nasdaq Composite Index and the
Russell 2000 Index. The graph assumes $100 was invested at the market close on April 16, 2015 in the common stock of Etsy,
Inc. Such returns are based on historical results and are not intended to suggest future performance. The Nasdaq Composite
Index and Russell 2000 Index assume reinvestment of any dividends.
This performance graph shall not be deemed “filed” with the SEC for purposes of Section 18 of the Exchange Act, or
incorporated by reference into any of our other filings under the Securities Act or the Exchange Act.
49
Item 6. Selected Consolidated Financial and Other Data.
The following tables show selected consolidated financial data. The selected Consolidated Statements of Operations data for
the years ended December 31, 2018, 2017, and 2016, and the selected Consolidated Balance Sheet data as of December 31,
2018 and 2017, are derived from our audited Consolidated Financial Statements and related notes included elsewhere in this
Annual Report on Form 10-K. The selected Consolidated Statement of Operations data for the years ended December 31, 2015
and 2014, and the selected Consolidated Balance Sheets data as of December 31, 2016, 2015, and 2014 is derived from our
audited Consolidated Financial Statements and related notes not included in this Annual Report.
The following tables also show certain unaudited operational and non-GAAP financial measures as well as a reconciliation
between certain GAAP and non-GAAP measures. The selected consolidated financial data and key metrics should be read
together with “Management’s Discussion and Analysis of Financial Condition and Results of Operations” and our Consolidated
Financial Statements and related notes included elsewhere in this Annual Report. See “Management’s Discussion and Analysis
of Financial Condition and Results of Operations—Key Operating and Financial Metrics” for the definitions of the following
terms: “active buyer,” “active seller,” “Adjusted EBITDA,” “GMS,” “international GMS,” and “mobile GMS.”
Our historical results and key metrics are not necessarily indicative of future results.
Consolidated Statements of Operations Data:
Revenue:
Marketplace (1)
Services (1)
Other
Total revenue
Cost of revenue (2)(3)
Gross profit
Operating expenses:
Marketing (2)(3)
Product development (2)(3)
General and administrative (2)(3)
Asset impairment charges
Total operating expenses
Income (loss) from operations
Other (expense) income, net
Income (loss) before income taxes
Benefit (provision) for income taxes (4)
2018
2017
2016
2015
2014
Year Ended December 31,
(in thousands except share and per share amounts)
$
440,740
$
326,076
$
269,628
$
204,333
$
156,821
158,928
4,025
603,693
190,762
412,931
158,013
97,249
82,883
—
338,145
74,786
(19,708)
55,078
22,413
111,869
3,286
441,231
150,986
290,245
109,085
74,616
91,486
3,162
278,349
11,896
20,369
32,265
49,535
89,433
5,906
364,967
123,328
241,639
82,248
55,083
86,180
551
224,062
17,577
(20,453)
(2,876)
(27,025)
64,923
4,243
273,499
96,979
176,520
66,771
42,694
68,939
—
178,404
(1,884)
(26,110)
(27,994)
(26,069)
34,413
4,357
195,591
73,633
121,958
39,655
36,634
51,920
—
128,209
(6,251)
(4,009)
(10,260)
(4,983)
Net income (loss)
$
77,491
$
81,800
$
(29,901) $
(54,063) $
(15,243)
Net income (loss) per share attributable to common stockholders:
Basic
Diluted
$
$
0.64
0.61
$
$
0.69
0.68
$
$
(0.26) $
(0.26) $
(0.59) $
(0.59) $
(0.38)
(0.38)
Weighted average common shares outstanding:
Basic
Diluted
120,146,076
118,538,687
113,562,738
91,122,291
40,246,663
127,084,785
122,267,673
113,562,738
91,122,291
40,246,663
50
(1) In connection with the adoption of ASU 2014-09—Revenue from Contracts with Customers (“ASC 606”) in the first
quarter of 2018, we renamed our revenue categories Marketplace and Services revenue. In addition, we reclassified Etsy
Payments from Services to Marketplace revenue as described in “Note 2—Revenue.” The following table provides our
Marketplace and Services revenue under our previous and current presentation:
Year-to-Date Period Ended
Previous Presentation
Updated Presentation
Marketplace Revenue
Services Revenue
Marketplace Revenue
Services Revenue
$
179,492
$
258,453
$
326,076
$
(in thousands)
158,204
132,648
108,732
200,857
136,608
82,502
269,628
204,333
156,821
111,869
89,433
64,923
34,413
December 31, 2017
December 31, 2016
December 31, 2015
December 31, 2014
(2) Includes total stock-based compensation expense as follows:
2018
2017
2016
2015
2014
Year Ended December 31,
(in thousands)
Cost of revenue
Marketing
Product development
General and administrative
Total stock-based compensation expense
$
$
3,357
$
1,739
$
1,057
$
2,507
21,234
11,133
1,933
8,274
14,613
971
5,079
8,794
$
871
560
2,860
6,550
1,113
216
1,461
7,260
38,231
$
26,559
$
15,901
$
10,841
$
10,050
(3) Includes the impact of $0.2 million in restructuring and other exit income recognized in the year ended December 31,
2018 and $13.9 million in restructuring and other exit costs recognized in the year ended December 31, 2017. For a
summary of restructuring and other exit costs (income), see “Note 17—Restructuring and Other Exit Costs (Income)” in
the Notes to Consolidated Financial Statements.
(4) In the year ended December 31, 2018, we recognized an income tax benefit associated with the release of a valuation
allowance on certain deferred tax assets. The valuation allowance release resulted in a non-recurring benefit for income
taxes of $23.4 million for the year ended December 31, 2018. In the year ended December 31, 2017, we recognized an
income tax benefit associated with the enactment of the Tax Cuts and Jobs Act (the “TCJA”). As a result of the TCJA,
our deferred taxes at December 31, 2017 have been revalued at the reduced 21% corporate income tax rate. The
revaluation resulted in a non-recurring benefit for income taxes of approximately $31.1 million for the year ended
December 31, 2017.
Other Operational and Non-GAAP Financial Data:
GMS
Adjusted EBITDA
Active sellers
Active buyers
Percent mobile GMS
Percent international GMS
2018
2017
2016
2015
2014
Year Ended December 31,
(in thousands except percentages)
$
$
3,931,745
139,510
$
$
2,115
39,447
55%
35%
3,253,609
80,009
1,933
33,364
51%
33%
$
$
2,841,985
57,124
1,748
28,566
48%
30%
$
$
2,388,387
31,007
1,563
24,046
43%
30%
$
$
1,931,981
23,081
1,353
19,810
37%
31%
51
Net income (loss)
Excluding:
Interest and other non-operating expense, net
(Benefit) provision for income taxes
Depreciation and amortization
Stock-based compensation expense (1)
Stock-based compensation expense—
acquisitions
Foreign exchange loss (gain)
Restructuring and other exit costs (income)
Asset impairment charges
Acquisition-related expenses
Net unrealized loss on warrant and other
liabilities
Contribution to Good Work Institute (formerly
Etsy.org)
2018
2017
2016
2015
2014
Year Ended December 31,
$
77,491
$
81,800
$
(29,901) $
(54,063) $
(15,243)
(in thousands)
13,221
(22,413)
26,742
34,477
3,754
6,487
(249)
—
—
—
—
8,736
(49,535)
27,197
19,953
3,904
(29,105)
13,897
3,162
—
—
—
5,502
27,025
22,525
13,168
2,733
14,951
—
551
570
—
—
1,202
26,069
18,550
8,981
1,860
21,775
—
—
—
3,133
3,500
549
4,983
17,223
5,920
4,130
3,049
—
—
2,059
411
—
Adjusted EBITDA
$
139,510
$
80,009
$
57,124
$
31,007
$
23,081
(1) $2.7 million of restructuring-related stock-based compensation expense has been excluded from the year ended
December 31, 2017, and is included in the restructuring and other exit costs (income) line.
2018
2017
2016
2015
2014
As of December 31,
(in thousands)
Consolidated Balance Sheet Data:
Cash, cash equivalents and short-term investments
$
624,287
$
340,550
$
282,086
$
292,864
$
Net working capital
Total assets
Deferred revenue
Long-term debt, net (1)
Long-term liabilities
Convertible preferred stock
Total stockholders’ equity
568,227
901,851
7,478
276,486
388,891
—
336,787
605,583
6,262
—
287,024
581,193
5,648
—
106,212
152,428
—
—
400,898
396,894
344,757
278,932
553,061
4,712
—
142,441
—
330,498
88,843
85,608
246,203
3,452
—
57,450
80,212
67,088
(1) In March 2018, we issued $345.0 million aggregate principal amount of 0% Convertible Senior Notes due 2023 in a
private placement to qualified institutional buyers pursuant to Rule 144A under the Securities Act. For more information
on the Notes, see “Note 13—Debt” in the Notes to Consolidated Financial Statements.
52
Item 7. Management’s Discussion and Analysis of Financial Condition and Results of Operations.
You should read the following discussion and analysis of our financial condition and results of operations together with our
Consolidated Financial Statements and related notes and other financial information included elsewhere in this Annual Report
on Form 10-K. This discussion, particularly information with respect to our outlook, our plans and strategy for our business
and our performance and future success, includes forward-looking statements that involve risks and uncertainties. Our actual
results could differ materially from those discussed below. Factors that could cause or contribute to these differences include
those discussed below and elsewhere in this Annual Report, particularly in the “Risk Factors” section. For more information
regarding key factors affecting our performance, see “Key Factors Affecting Our Performance” below.
Overview
Business
Etsy is the global two-sided marketplace for unique and creative goods. Our mission is to “Keep Commerce Human,” and
we’re committed to using the power of business and technology to strengthen communities and empower people around the
world. We connect creative entrepreneurs with thoughtful consumers looking for items that are intended to be special, reflect
their sense of style, or represent a meaningful occasion.
Our sellers are the heart and soul of Etsy, and our technology platform allows our sellers to turn their creative passions into
economic opportunity. We have a seller-aligned business model: we make money when our sellers make money. We offer our
sellers a marketplace with millions of buyers along with a range of seller tools and services that are specifically designed to
help our creative entrepreneurs generate more sales and scale their businesses.
We are focused on attracting potential buyers to the Etsy marketplace for “special” purchase occasions throughout the year and
deepening engagement with our existing buyers by inspiring purchases across multiple categories and special occasions. These
special purchase occasions can occur many times throughout the year and include shopping that reflects an individual's unique
style; gifting that demonstrates thought and care; and celebrations that express creativity and fun. Buyers tell us that they come
to Etsy because Etsy sellers offer items that they can’t find anywhere else. Special purchase occasions happen throughout the
year when a buyer is decorating a home, dressing for an event, celebrating a special moment, or buying a gift for someone
special.
Our revenue is diversified, generated from a mix of marketplace activities and other optional services we provide to Etsy sellers
to help them generate more sales and scale their businesses.
Marketplace revenue is comprised of the fees an Etsy seller pays us for marketplace activities. Marketplace activities include
listing an item for sale, completing transactions between a buyer and a seller, and using Etsy Payments to process payments,
including foreign currency payments. Revenue from Etsy Payments, our payment processing product, included in Services
revenue prior to 2018, is now included in Marketplace revenue because Etsy Payments is required to be used by Etsy sellers in
the countries where it is available.
Services revenue, called Seller Services revenue prior to 2018, is comprised of the fees an Etsy seller pays us for our optional
other services (“Services”). Services include Promoted Listings, our on-site advertising service that allows sellers to pay for
prominent placement of their listings in search results; Etsy Shipping Labels, which allows sellers in the United States, Canada,
United Kingdom, and Australia to purchase discounted shipping labels; Pattern, a service that allows sellers to build custom
websites; and Etsy Plus, a subscription offering that provides sellers with enhanced tools and credits for use on our platform.
We also generate additional revenue through our commercial partnerships, which is classified as other revenue.
Our strategy is focused on growing our Etsy.com marketplace in our six core geographies and building a sustainable
competitive advantage around four areas of our business that we believe differentiate us from our competitors, or what we call
our “Right to Win.”
The foundation of Etsy’s competitive advantage is our collection of unique items, which, we believe, when combined with best-
in-class search and discovery, human connections, and a trusted brand, will enable us to continue to stand out among other
ecommerce platforms and marketplaces. Our investments in product, marketing, and talent will be focused on capitalizing on
these four areas of our business. Ultimately, the goal of our long-term strategy is to drive more new buyers to the website, give
existing buyers reasons to come back more often, and fuel success for our sellers.
53
Year Highlights
Total revenue was $603.7 million in the year ended December 31, 2018, driven by growth in both Marketplace and Services
revenue. In the year ended December 31, 2018, we recorded net income of $77.5 million, and non-GAAP Adjusted EBITDA of
$139.5 million. See “Non-GAAP Financial Measures” for more information and for a reconciliation of Adjusted EBITDA to
net income (loss), the most directly comparable financial measure calculated in accordance with GAAP.
As of December 31, 2018, our marketplace connected 2.1 million active Etsy sellers and 39.4 million active Etsy buyers, in
nearly every country in the world. In the year ended December 31, 2018, Etsy sellers generated GMS of $3.9 billion, of which
approximately 55% came from purchases made on mobile devices. We are a global company and 35% of our GMS in the year
ended December 31, 2018 came from transactions where either an Etsy seller or an Etsy buyer was located outside of the
United States.
2018 Pricing Updates
Effective July 16, 2018, we increased our seller transaction fee from 3.5% to 5%, and now apply it to the cost of shipping in
addition to the cost of the item. The revised fee structure is intended to support increased investments in the growth and health
of the marketplace. We believe these pricing updates will continue to have a positive effect on revenue.
We also announced new subscription packages and enhanced tools that are intended to support global sellers at different stages
of their business life cycles. In mid-July, we launched Etsy Plus, which sellers can opt into for $10 per month. Sellers may also
choose Etsy Standard and continue to have access to the same tools and services that are already available on Etsy without an
additional monthly fee. Given that our learnings on subscription packages are still nascent, we are continuing to evaluate and
learn from the recent launch of Etsy Plus and will evaluate the best strategy for our current and planned subscription packages
going forward as we optimize for seller success.
Other Operational Highlights
In 2018 we focused on growing our Etsy.com marketplace in our core geographies, and owning special purchase occasions –
style, gifting, and celebrations – throughout the year. Below are key operational highlights:
• We continued to launch new product enhancements and build upon prior launches to help buyers find the right product
at the right time, or discover inspiration among the items in our marketplace. We improved search relevance using
context specific ranking (“CSR”), optimized landing pages by adding more recommendations and notifications,
including alerts on listing cards when scarce items appear in other people’s carts, and reduced friction in the search
and discovery experience by accelerating home and search page load times.
• We launched several product enhancements aimed at bolstering trust in the Etsy brand, Etsy sellers, the items available
in our marketplace, and the overall Etsy experience. We made customer support improvements by introducing live
chat for our sellers and inbound phone support for both buyers and sellers. We improved our checkout experience to
make it easier for buyers to provide information for personalization and customization details on the listing and cart
pages, enhanced guest checkout on mobile web and introduced Klarna, a pay later option for buyers in Germany. We
also added trust signals to give more confidence in making a purchase decision, including best-seller badges on listing
cards and shop review ratings on the cart page.
• We continued to focus on utilizing our marketing efforts to drive new and existing buyers to Etsy. We made structural
improvements to Search Engine Optimization, one of our largest channels, to drive incremental traffic to Etsy. We
began sending on-site and email notifications to inform buyers when one of their recently favorited items goes on sale.
Additionally, following the increase in our marketplace transaction fee, we were able to invest a portion of our
incremental revenue into marketing. We ran our first-ever television advertising campaign in the U.S and also began to
test offline marketing campaigns.
• We continued to enhance, expand and introduce new product offerings and seller tools. We optimized Promoted
Listings by using context specific ranking to surface more relevant ads, and launched a tool to better utilize seller’s
budgets. We focused on shipping improvements, including the expansion of the Etsy Shipping Labels offering to our
sellers in the United Kingdom and Australia through our new agreements with Royal Mail and DAI Post. We also
launched Etsy Plus and Targeted Offers, new products and tools designed to give sellers more ways to grow their
businesses and brands. Additionally, we launched a redesigned payment account intended to make it easier to manage
54
all seller shop finances in one place, and have begun to process charges in the seller’s ledger currency and
automatically deduct fees and applicable taxes from the seller’s money earned through sales using Etsy Payments.
We have also focused on growth investments, such as our migration to Google Cloud. In 2018, we achieved a significant
milestone in the process by successfully migrating our website and mobile apps to Google Cloud. We expect to complete the
migration by the beginning of 2020, and anticipate spending approximately $25 million on cloud migration in 2019.
Additionally, during the migration we will maintain some of our existing data center infrastructure to ensure the reliability of
our platform. We believe that moving to Google Cloud is positioning us well for growth by allowing us to focus on strategic
initiatives, enhance site performance, and improve engineering efficiency.
Reclassification of Revenue Categories
In connection with the adoption of ASU 2014-09—Revenue from Contracts with Customers (“ASC 606”) in the first quarter of
2018, we renamed our revenue categories Marketplace and Services revenue. In addition, we reclassified Etsy Payments from
Services to Marketplace revenue as described in “Business” above.
The following table provides our Marketplace and Services revenue under our previous and current presentation for the years
ended December 31, 2017 and 2016:
Previous Presentation
Updated Presentation
Marketplace Revenue
Services Revenue
Marketplace Revenue
Services Revenue
Year-to-Date Period Ended
December 31, 2017
December 31, 2016
$
179,492
$
158,204
(in thousands)
258,453
$
200,857
326,076
$
269,628
111,869
89,433
Key Operating and Financial Metrics
We collect and analyze operating and financial data to evaluate the health and performance of our business and allocate our
resources (such as capital, people and technology investments). The unaudited non-GAAP financial measure and key operating
and financial metrics we use are:
Year Ended December 31,
2018
2017
% Growth
(Decline)
Y/Y
Year Ended
December 31,
2016
% Growth
Y/Y
(in thousands except percentages)
$
$
$
$
$
$
3,931,745
603,693
440,740
158,928
77,491
139,510
$
$
$
$
$
$
3,253,609
441,231
326,076
111,869
81,800
80,009
2,115
39,447
55%
35%
1,933
33,364
51%
33%
20.8%
36.8%
35.2%
42.1%
(5.3)%
74.4%
9.4%
18.2%
400 bps
200 bps
$
$
$
$
$
$
2,841,985
364,967
269,628
89,433
(29,901)
57,124
1,748
28,566
48%
30%
14.5%
20.9%
20.9%
25.1%
373.6%
40.1%
10.6%
16.8%
300 bps
300 bps
GMS
Revenue
Marketplace revenue
Services revenue
Net income (loss)
Adjusted EBITDA
Active sellers
Active buyers
Percent mobile GMS
Percent international GMS
GMS
Gross merchandise sales (“GMS”) is the dollar value of items sold in our marketplace within the applicable period, excluding
shipping fees and net of refunds associated with canceled transactions. GMS does not represent revenue earned by Etsy. GMS
is largely driven by transactions in our marketplace and is not directly impacted by Services activity. However, because our
revenue and cost of revenue depend significantly on the dollar value of items sold in our marketplace, we believe that GMS is
an indicator of the success of Etsy sellers, the satisfaction of Etsy buyers, and the health, scale, and growth of our business.
55
Adjusted EBITDA
Adjusted EBITDA represents our net income (loss) adjusted to exclude: interest and other non-operating expense, net; (benefit)
provision for income taxes; depreciation and amortization; stock-based compensation expense; foreign exchange loss (gain);
restructuring and other exit costs (income) related to the Actions discussed in “Non-GAAP Financial Measures;” asset
impairment charges; acquisition-related expenses; net unrealized loss on warrant and other liabilities; and contributions to
Good Work Institute (formerly Etsy.org). See “Non-GAAP Financial Measures” for more information regarding our use of
Adjusted EBITDA, including its limitations as a financial measure, and for a reconciliation of Adjusted EBITDA to net income
(loss), the most directly comparable financial measure calculated in accordance with GAAP.
Active Sellers
An active seller is an Etsy seller who has incurred at least one charge from us in the last 12 months. Charges include
Marketplace, Services, and Other Revenue fees discussed in “Note 1—Basis of Presentation and Summary of Significant
Accounting Policies —Revenue Recognition” in the Notes to Consolidated Financial Statements. An Etsy seller is identified by
a unique e-mail address; a single person can have multiple Etsy seller accounts. We succeed when Etsy sellers succeed, so we
view the number of active sellers as a key indicator of the awareness of our brand, the reach of our platform, the potential for
growth in GMS and revenue, and the health of our business.
Active Buyers
An active buyer is an Etsy buyer who has made at least one purchase in the last 12 months. An Etsy buyer is identified by a
unique e-mail address; a single person can have multiple Etsy buyer accounts. We generate revenue when Etsy buyers order
items from Etsy sellers, so we view the number of active buyers as a key indicator of our potential for growth in GMS and
revenue, the reach of our platform, awareness of our brand, the engagement and loyalty of Etsy buyers, and the health of our
business.
Mobile GMS
Mobile GMS is GMS that results from a transaction completed on a mobile device, such as a tablet or a smartphone. Mobile
GMS excludes A Little Market (“ALM”) and Etsy Wholesale and orders initiated on mobile devices but ultimately completed
on a desktop. When calculating percent mobile GMS, we do not take into account refunds associated with canceled
transactions. We believe that mobile GMS indicates our success in converting mobile activity into mobile purchases and
demonstrates our ability to grow GMS and revenue.
International GMS
International GMS is GMS from transactions where either the billing address for the Etsy seller or the shipping address for the
Etsy buyer at the time of sale is outside of the United States. When calculating percent international GMS, we do not take into
account refunds associated with canceled transactions. We believe that international GMS shows the level of engagement of our
community outside the United States and demonstrates our ability to grow GMS and revenue.
Currency-Neutral GMS Growth
We calculate currency-neutral GMS growth by translating current period GMS for goods sold that were listed in non-U.S.
dollar currencies into U.S. dollars using prior year foreign currency exchange rates.
As reported and currency-neutral GMS growth for the periods presented below is as follows:
December 31, 2018
December 31, 2017
December 31, 2016
Year-to-Date Period Ended
As Reported
Currency-Neutral
FX Impact
20.8%
14.5%
19.0%
20.4%
14.3%
20.0%
0.4%
0.2%
(1.0)%
56
Non-GAAP Financial Measures
Adjusted EBITDA
In this Annual Report on Form 10-K, we provide Adjusted EBITDA, a non-GAAP financial measure that represents our net
income (loss) adjusted to exclude: interest and other non-operating expense, net; (benefit) provision for income taxes;
depreciation and amortization; stock-based compensation expense; foreign exchange loss (gain); restructuring and other exit
costs (income) related to the Actions as defined below; asset impairment charges; and acquisition-related expenses. Below is a
reconciliation of Adjusted EBITDA to net income (loss), the most directly comparable GAAP financial measure.
We have included Adjusted EBITDA because it is a key measure used by our management and Board of Directors to evaluate
our operating performance and trends, allocate internal resources, prepare and approve our annual budget, develop short- and
long-term operating plans, determine incentive compensation, and assess the health of our business. As our Adjusted EBITDA
increases, we are able to invest more in our platform.
We believe that Adjusted EBITDA can provide a useful measure for period-to-period comparisons of our business as it removes
the impact of certain non-cash items and certain variable charges.
Adjusted EBITDA has limitations as an analytical tool, and you should not consider it in isolation or as a substitute for analysis
of our results as reported under GAAP. Some of these limitations are:
• Adjusted EBITDA does not reflect other non-operating expenses, net of other non-operating income, including net interest
expense;
• Adjusted EBITDA does not reflect tax payments that may represent a reduction in cash available to us;
• although depreciation and amortization are non-cash charges, the assets being depreciated and amortized may have to be
replaced in the future, and Adjusted EBITDA does not reflect cash capital expenditure requirements for such replacements
or for new capital expenditure requirements;
• Adjusted EBITDA does not consider the impact of stock-based compensation expense;
• Adjusted EBITDA does not consider the impact of foreign exchange loss (gain);
• Adjusted EBITDA does not consider the impact of restructuring and other exit costs (income) related to the Actions as
described below;
• Adjusted EBITDA does not consider the impact of asset impairment charges;
• Adjusted EBITDA does not reflect acquisition-related expenses; and
•
other companies, including companies in our industry, may calculate Adjusted EBITDA differently, which reduces its
usefulness as a comparative measure.
Because of these limitations, you should consider Adjusted EBITDA alongside other financial performance measures, including
net income (loss) and our other GAAP results.
57
The following table reflects the reconciliation of net income (loss) to Adjusted EBITDA for each of the periods indicated:
Net income (loss)
Excluding:
Interest and other non-operating expense, net (1)
(Benefit) provision for income taxes
Depreciation and amortization (1)
Stock-based compensation expense (2)
Stock-based compensation expense—acquisitions
Foreign exchange loss (gain) (3)
Restructuring and other exit costs (income) (4)
Asset impairment charges (5)
Acquisition-related expenses
Adjusted EBITDA
Year Ended December 31,
2018
2017
2016
$
77,491
$
81,800
$
(29,901)
(in thousands)
13,221
(22,413)
26,742
34,477
3,754
6,487
(249)
—
—
8,736
(49,535)
27,197
19,953
3,904
(29,105)
13,897
3,162
—
5,502
27,025
22,525
13,168
2,733
14,951
—
551
570
$
139,510
$
80,009
$
57,124
(1) Included in interest and depreciation expense amounts above are interest and depreciation expense related to our
headquarters under build-to-suit accounting requirements, which commenced in May 2016. For the years ended
December 31, 2018, 2017, and 2016 those amounts are as follows:
Interest expense
Depreciation
Year Ended December 31,
2018
2017
2016
(in thousands)
$
8,996
$
3,276
9,000
$
3,276
5,337
2,186
(2) $2.7 million of restructuring-related stock-based compensation expense has been excluded from the year ended
December 31, 2017 and is included in the restructuring and other exit costs (income) line. See footnote (4) below. Total
stock-based compensation expense included in the Consolidated Statements of Operations is as follows:
Cost of revenue
Marketing
Product development
General and administrative
Total stock-based compensation expense
Year Ended December 31,
2018
2017
2016
$
$
(in thousands)
3,357
$
1,739
$
2,507
21,234
11,133
1,933
8,274
14,613
38,231
$
26,559
$
1,057
971
5,079
8,794
15,901
(3) See “Results of Operations—Other (Expense) Income, net” for more information on the fluctuation in foreign
exchange loss (gain) in the years ended December 31, 2018, 2017, and 2016.
(4) Total restructuring and other exit costs (income) included in the Consolidated Statements of Operations are as follows:
Cost of revenue
Marketing
Product development
General and administrative
Total restructuring and other exit costs (income)
Year Ended December 31,
2018
2017
2016
(in thousands)
(19) $
738
$
(82)
(110)
(38)
2,950
3,232
6,977
(249) $
13,897
$
—
—
—
—
—
$
$
58
(5)
In the fourth quarter of 2017, we made the decision to discontinue certain product offerings, including Etsy Studio and
Etsy Manufacturing, which resulted in the recognition of a $3.2 million impairment charge to write the related
capitalized web development and internal-use software assets down to zero. This decision was based on our strategy to
focus on the growth of the Etsy.com marketplace.
Consolidated Statement of Operations Line Items Excluding Restructuring and Other Exit Costs (Income)
In the second quarter of 2017, the Board of Directors approved plans to increase efficiency and streamline our cost structure
and improve focus on key strategic growth opportunities (the “Actions”). In this Annual Report, we discuss certain financial
statement line items excluding restructuring and other exit costs (income), each non-GAAP financial measure that represents
the income statement line item adjusted to exclude restructuring and other exit costs (income) incurred in the years ended
December 31, 2018 and 2017.
We have included these financial statement line items excluding restructuring and other exit costs (income) because the Actions
were unusual and do not necessarily reflect the ongoing trends in these financial statement line items. We believe that these
non-GAAP measures can provide a useful measure for period-to-period comparisons of our business as they remove the impact
of the Actions.
These non-GAAP measures have limitations as analytical tools, and you should not consider them in isolation or as a substitute
for analysis of our results as reported under GAAP. Some of these limitations are:
• many of these costs were settled in cash;
•
there is no certainty that restructuring and other exit costs (income) will not recur; and
•
other companies, including companies in our industry, may adjust for similar items in a different manner, or may not
exclude such charges, which reduces its usefulness as a comparative measure.
Because of these limitations, you should consider these non-GAAP measures alongside other financial performance measures,
including the GAAP financial statement line items.
Reconciliation of GAAP Consolidated Statement of Operations Line Items to Non-GAAP Line Items Excluding
Restructuring and Other Exit Costs (Income)
The following table reflects the reconciliation of each affected GAAP line item of the Consolidated Statement of Operations to
the non-GAAP line item excluding restructuring and other exit costs (income) for each of the periods indicated:
Year Ended December 31, 2018
As Reported
Restructuring and Other Exit
Costs (Income)
Excluding Restructuring and
Other Exit Costs (Income)
(in thousands)
— $
(19)
(19)
(82)
(110)
(38)
(230)
(249) $
603,693
190,781
412,912
158,095
97,359
82,921
338,375
74,537
Revenue
Cost of revenue
Gross profit
Operating expenses:
Marketing
Product development
General and administrative
Total operating expenses
Income from operations
$
$
603,693
$
190,762
412,931
158,013
97,249
82,883
338,145
74,786
$
59
Year Ended December 31, 2017
As Reported
Restructuring and Other Exit
Costs (Income)
Excluding Restructuring and
Other Exit Costs (Income)
(in thousands)
$
Revenue
Cost of revenue
Gross profit
Operating expenses:
Marketing
Product development
General and administrative
Asset impairment charges
Total operating expenses
441,231
$
150,986
290,245
109,085
74,616
91,486
3,162
278,349
Income from operations
$
11,896
$
— $
738
738
2,950
3,232
6,977
—
13,159
13,897
$
441,231
150,248
290,983
106,135
71,384
84,509
3,162
265,190
25,793
60
Key Factors Affecting Our Performance
We believe that our performance and future success depend on a number of factors that present significant opportunities for us
but also pose risks and challenges, including those discussed in the section titled “Risk Factors.”
Growth and Retention of Active Buyers and Active Sellers
Our success depends in part on the growth and retention of our active buyers and active sellers. Our revenue is driven by the
number of active buyers, buyer engagement, active sellers, seller engagement, and our ability to maintain a trusted marketplace.
As of December 31, 2018, our marketplace had grown to 39.4 million active buyers and 2.1 million active sellers, up from 33.4
million active buyers and 1.9 million active sellers as of December 31, 2017. We believe two of our most significant
opportunities to drive growth in our marketplace are to bring new buyers to Etsy and encourage repeat buyers to purchase more
frequently. We are particularly focused on increasing our number of habitual buyers, or buyers who have spent $200 or more
and made purchases on six or more purchase days in the year. We are also focused on keeping our best sellers on the platform
and helping them grow their businesses by enhancing the seller tools and services that help drive buyer demand.
During 2018, Etsy had 17.5 million new buyers, or buyers who
made their first-ever purchase on Etsy. GMS from new
buyers was up 16% year-over-year and represented
approximately 18% of overall GMS, a slight decrease
compared to last year. GMS from existing buyers
grew 23% year-over-year in 2018 and represented
approximately 82% of overall GMS, an increase compared to
last year. Repeat purchases demonstrate the loyalty of Etsy
buyers. In 2018, approximately 40.1% of our active buyers
made purchases on two or more days in the previous 12
months, up from 39.6% in 2017.
Habitual buyers, are approximately 5.2% of our active buyers
as of December 31, 2018. Habitual buyers grew to 2.0 million
as of December 31, 2018, an increase of 21.7% compared to
2017. We aim to increase repeat purchases and habitual buyers
by inspiring purchases in additional categories and on
additional occasions, building trust in the Etsy brand, and
removing friction from the buying experience to improve
conversion rates.
To analyze our retention rates, we measure repeat activity by
Active Buyers (buyers who have made at least one purchase
through Etsy in the last 12 months) and Active Sellers (sellers
who have incurred at least one charge in the last 12 months).
61
Cohort of 2015, 2014, 2013, 2012 and 2011 Active Buyers
We refer to active buyers as of December 31, 2015 as “2015 Active Buyers,” as of December 31, 2014 as “2014 Active
Buyers,” as of December 31, 2013 as “2013 Active Buyers,” as of December 31, 2012 as “2012 Active Buyers,” and as of
December 31, 2011 as “2011 Active Buyers.” Of total 2015 Active Buyers, 37.5% remained active buyers through their fourth
year on the platform, compared to 38.7% for 2014 Active Buyers, 41.1% for 2013 Active Buyers, 42.5% for 2012 Active
Buyers, and 44.7% for 2011 Active Buyers. The average annual GMS per 2015 Active Buyer during their fourth year on the
platform was 78% higher than their first year, compared to 70% for 2014 Active Buyers, 81% for 2013 Active Buyers, 88% for
2012 Active Buyers, and 89% for 2011 Active Buyers. We note that 2013 was the first year we started to significantly invest in
our paid acquisition marketing efforts to grow our buyer base.
AVG GMS
PER BUYER
2011
2012
2013
2014
2015
$103
$96
$96
$99
$101
$177
$163
$161
$157
$158
$186
$173
$168
$164
$163
$195
$181
$174
$169
$180
Cohort of 2015, 2014, 2013, 2012, and 2011 Active Buyers
These cohort data demonstrate our ability to consistently retain buyers over a multi-year period and reflects the loyalty of our
buyer base. We have identified our ability to increase purchase frequency among these long-term and habitual buyers as one of
our significant opportunities for growth and we are focused on improving search and recommendations to better match our
buyers with the 60 million items listed on Etsy.com, driving buyer growth and retention.
62
Cohort of 2015, 2014, 2013, 2012 and 2011 Active Sellers
We refer to active sellers as of December 31, 2015 as “2015 Active Sellers,” as of December 31, 2014 as “2014 Active Sellers,”
as of December 31, 2013 as “2013 Active Sellers,” as of December 31, 2012 as “2012 Active Sellers” and December 31, 2011
as “2011 Active Sellers.” Of the 2015 Active Sellers, 33.1% remained active through their fourth year on the platform,
compared to 31.8% for 2014 Active Sellers, 31.5% for 2013 Active Sellers, 32.3% for 2012 Active Sellers, and 32.3% for 2011
Active Sellers. The average annual GMS per 2015 Active Seller during their fourth year on the platform was over three times
higher than their first year, compared to over three times higher for 2014 Active Sellers, almost four times higher for 2013
Active Sellers, over four times higher for 2012 Active Sellers, and over five times higher for 2011 Active Sellers.
AVG GMS
PER SELLER
2011
2012
2013
2014
2015
$817
$2,241
$3,314
$4,299
$1,079
$2,598
$3,935
$4,557
$1,260
$3,110
$4,190
$4,620
$1,465
$3,325
$4,228
$4,615
$1,558
$3,296
$4,062
$4,939
Cohort of 2015, 2014, 2013, 2012, and 2011 Active Sellers
These cohort data demonstrate our success in retaining sellers over a multi-year period, with the sellers that remain on our
platform maintaining consistent GMS growth. We believe there is significant opportunity for growth by fueling seller success
through continued investment in paid services and tools to help Etsy sellers generate more sales on our platform.
63
Services Growth
We have a seller-aligned business model: we make money when Etsy sellers make money. Our goal is to enhance the seller
tools and services that will drive buyer demand. To achieve this, we continue to invest our resources in developing a cohesive
platform of paid services and free tools specifically designed to help our creative entrepreneurs generate more sales and scale
their businesses. We believe we can grow our optional paid services in three ways: expand the utility of existing services,
expand the geographic reach of existing services, and launch new services offerings. For December 31, 2018, 15.1% of active
sellers used Promoted Listings, and 24.7% of active sellers in the United States, Canada, United Kingdom, and Australia used
Etsy Shipping Labels.
Investment in Marketing
We are focusing on initiatives to drive traffic to Etsy.com and shape perceptions of our marketplace as the go-to shopping
destination for special purchase occasions by investing primarily in digital and other marketing initiatives, such as search
engine optimization and television channels, and in our team to support marketing activities. We believe that we can continue to
grow our acquisition marketing efforts, both in scaling and improving our current efforts and by expanding into new marketing
channels. In 2018, paid GMS attributable to our marketing efforts was 17% of GMS and grew 53% compared to 2017.
Additionally, following the increase in our marketplace transaction fee, we were able to invest a portion of our incremental
revenue into marketing. In 2018, we ran our first-ever television advertising campaign in the United States and also began to
test offline marketing campaigns. We believe these campaigns can increase brand awareness, visits, and purchase intent. In
2018, we spent $158.0 million on marketing expenses, or 26.2% of revenue, up 44.9% over 2017. In 2017, we spent $109.1
million on marketing expenses, or 24.7% of revenue, up 32.6% over 2016.
Investment in Technology
Our engineering team has built a sophisticated platform that enables millions of Etsy sellers and Etsy buyers to smoothly
transact across borders, languages and devices. We have made, and will continue to make, significant investments in our
platform to attract buyers and sellers to our marketplace and enhance their experience.
In September 2016, we acquired Blackbird Technologies, Inc., (“Blackbird”), a machine learning company, and, during 2017,
fully integrated it into our search team. During 2017, we launched CSR, which leverages our internal data to create a more
personalized search experience. We continued to improve the search experience using CSR throughout 2018 and will continue
to leverage artificial intelligence and machine learning to enable shoppers to more easily browse, filter and transact, even when
they may not have something specific in mind.
Our technology infrastructure allows us to scale our efforts across the platform. In the fourth quarter of 2017, we began
working on an initiative to migrate our data centers to the cloud. We believe that moving to Google Cloud will enable us to
focus on growing our core Etsy.com marketplace, prioritizing the buyer and seller experience, improving our search and
discovery effectiveness, and increasing the pace of launching new features. In the third quarter of 2018, we achieved a
significant milestone in the process by successfully migrating our website and mobile apps to Google Cloud. While this
initiative is underway, we will incur implementation costs in addition to costs associated with maintaining our current
infrastructure. We expect to complete the migration by the beginning of 2020.
In 2018, we spent $97.2 million on product development expenses, or 16.1% of revenue, up 30.3% over 2017 and in 2017, we
spent $74.6 million on product development expenses, or 16.9% of revenue, up 35.5% over 2016. In addition, we capitalized
website development and internal-use software costs, including stock-based compensation, of $22.1 million and $10.8 million
in 2018 and 2017, respectively. We plan to continue to invest in innovation to address the needs of our community and increase
our efforts to recruit and hire employees to work on our engineering teams.
Investment in Connected Experience—Mobile and Desktop
We want to engage Etsy buyers wherever they are and to provide an enjoyable and accessible shopping experience no matter
what device they use to access our marketplace. Mobile is integrated into everything that we do, and expanding our mobile
capabilities is an important focus area. Our mobile website and our “Buy on Etsy” mobile apps for Etsy buyers include search,
discovery, curation, personalization, and social shopping features, optimized for a personal mobile experience. Our Etsy.com
iOS and Android mobile apps have been downloaded approximately 56 million times as of December 31, 2018. Mobile GMS
was 55% of total GMS in 2018, up from 51% of total GMS in 2017. We are focused on increasing conversion rates in general;
however, we are particularly focused on mobile web, which continued to be the largest driver of both overall visits growth and
mobile GMS growth. Mobile web conversion rate is about half the conversion rate on desktop and the conversion rate on our
64
mobile Buy on Etsy app is about 1.2x the desktop conversion rate. Therefore, if mobile web visits continue to grow as a
percentage of overall visits, it could be a headwind to future conversion rate gains. We are focused on continuing to enhance the
buyer experience through mobile offering improvements in 2019.
International Growth
Our growth will depend in part on international Etsy sellers and international Etsy buyers constituting an increasing portion of
our community. Our vision is global and local. Etsy.com is available in 10 languages and supports buyers and sellers in nearly
every country in the world. In 2018, we entered into a referral agreement with DaWanda GmbH (“DaWanda”), a privately held
Germany-based marketplace for gifts and handmade items. As part of this agreement, DaWanda agreed to encourage its
community of buyers and sellers to migrate to the Etsy platform. The referral agreement with DaWanda allowed us to grow our
international business by expanding our footprint in Central Europe, particularly in Germany, one of our core geographic
markets. International GMS was 35% of total GMS in 2018 compared to 33% in 2017. We expect international GMS to grow
faster than U.S. GMS in 2019, assuming that currency rates remain stable compared to average levels in December 2018,
driven by our efforts to build local communities and foster local connections. In 2018, 37.5% of Etsy sellers were located
outside the United States. Cross-border transactions is the largest component of international GMS and we remain committed to
reducing barriers such as language and currency so that sellers and buyers from different countries can easily connect and
transact. GMS generated between a non-U.S. buyer and a non-U.S. seller both in the same country grew
approximately 36% in 2018 compared with 2017, making it the fastest growing category of international GMS. We are also
focused on building local marketplaces globally, and deepening local Etsy communities around the world, each with its own
ecosystem of Etsy sellers and Etsy buyers. To execute on our international strategy, we plan to continue to invest in local
marketing and other locally-relevant tools and enhancements, such as local search boost, to encourage these connections
around the world.
Our Company Culture
Our success depends, in part, on our ability to attract, retain, and motivate exceptional employees who share our dedication to
our community and our mission to “Keep Commerce Human.” We believe that our action-oriented, values-based and purpose-
driven work culture is a competitive advantage in attracting and retaining top talent.
We are focused on employee engagement, which is linked with high performance, retention, innovation, and growth. Each year,
Etsy conducts an internal survey to measure employee engagement. In 2018, our overall engagement score was 70% favorable,
up 10% from the prior year. We are also committed to fostering a diverse and inclusive workplace because we firmly believe
that diverse backgrounds, thoughts, and experiences are beneficial to innovation, decision making, and our business as a whole.
We are proud that as of December 31, 2018, our Board of Directors and leadership were at least 50% female.
Components of Our Results of Operations
Revenue
Our revenue consists of Marketplace revenue, Services revenue, and Other revenue.
Marketplace revenue. Marketplace revenue is primarily comprised of the 5% transaction fee that an Etsy seller pays for each
completed transaction, inclusive of shipping fees charged, the listing fee of $0.20 she pays for each item she lists (for up to four
months) on Etsy.com, and Etsy Payments, our payment processing service. On July 16, 2018, we increased our seller
transaction fee from 3.5% to 5%, and now apply it to the cost of shipping in addition to the cost of the item.
Services revenue. Services revenue is derived from optional services offered to Etsy sellers, which include Promoted Listings,
Etsy Shipping Labels, Pattern, and Etsy Plus.
• Revenue from Promoted Listings, our on-site advertising service, consists of cost-per-click fees an Etsy seller pays us for
prominent placement of her listings in search results in our marketplace.
• Revenue from Etsy Shipping Labels consists of fees an Etsy seller pays us when she purchases shipping labels directly
through our platform, net of the cost we incur in purchasing those shipping labels. We are able to provide our sellers
shipping labels from the United States Postal Service, FedEx, Canada Post, Royal Mail, and DAI Post at discounted
pricing due to the volume of purchases through our platform.
• Revenue from Pattern consists of monthly subscription fees an Etsy seller pays to use our custom website services.
65
• Revenue from Etsy Plus consists of monthly subscription fees an Etsy seller pays for enhanced tools and credits for use on
our platform.
Other revenue. Other revenue includes the fees we receive from commercial partnerships.
Our revenue recognition policies are discussed under “Critical Accounting Policies and Significant Judgments and Estimates.”
Cost of Revenue
Cost of revenue primarily consists of the cost of interchange and other fees for credit card processing services, credit card
verification service fees, and credit card chargebacks to support Etsy Payments revenue, and costs of refunds made to Etsy
buyers that we are not able to collect from Etsy sellers. Cost of revenue also includes expenses associated with the operation
and maintenance of our platform and our data centers, including employee-related costs, hosting and bandwidth costs, and
depreciation and amortization. Our cost of revenue as a percentage of revenue may change over time as our revenue mix
changes; for example, to the extent that Etsy Payments revenue increases as a percentage of revenue, there may be a dampening
effect on our gross margin, as Etsy Payments is a lower margin product compared to our other offerings.
Operating Expenses
Operating expenses consist of marketing, product development, general and administrative expenses, and asset impairment
charges. Direct and indirect employee-related expenses are the most significant component of the product development and
general and administrative expense categories. We include stock-based compensation expense in the applicable operating
expense category based on the respective equity award recipient’s function. We include restructuring and other exit costs
(income) related to the Actions in the applicable operating expense category of the impacted function.
Marketing: Marketing expenses largely consist of direct marketing and indirect employee-related expenses to support our
marketing initiatives. Direct marketing includes digital marketing, brand marketing and television, seller lifecycle and growth
activities, public relations, communications, and marketing partnerships. Digital marketing, also referred to as performance
marketing, primarily consists of targeted promotional campaigns through electronic channels, such as product listing ads,
search engine marketing, affiliate programs, and display advertising which are focused on buyer acquisition and brand
marketing.
Product development: Product development expenses consist primarily of employee-related expenses for our engineering,
product management, product design, and product research activities. Additional expenses include consulting costs related to
the development, quality assurance, and testing of new technology and enhancement of our existing technology.
General and administrative. General and administrative expenses consist primarily of employee-related expenses for our
general corporate functions. General and administrative expenses also include costs associated with the use of facilities and
equipment, including depreciation and amortization and office overhead, and certain professional services expenses.
Asset impairment charges: Asset impairment charges consist primarily of non-cash charges related to our decisions to
discontinue certain product offerings and the impairment of the related capitalized web development and internal-use software
costs.
Other (Expense) Income, net
Other (expense) income, net consists of interest expense, interest and other income, and foreign exchange (loss) gain. Interest
expense consists primarily of non-cash interest and amortization of debt issuance costs related to our Convertible Senior Notes
due 2023, interest associated with the build-to-suit accounting treatment of our Brooklyn headquarters lease, and, to a lesser
extent, interest on our capital lease obligations. Interest and other income is primarily comprised of interest and dividend
income from our investment accounts.
66
Results of Operations
The following tables show our results of operations for the periods presented and express the relationship of certain line items
as a percentage of revenue for those periods. The period-to-period comparison of financial results is not necessarily indicative
of future results.
Revenue:
Marketplace
Services
Other
Total revenue
Cost of revenue
Gross profit
Operating expenses:
Marketing
Product development
General and administrative
Asset impairment charges
Total operating expenses
Income from operations
Other (expense) income, net
Income (loss) before income taxes
Benefit (provision) for income taxes
Net income (loss)
Revenue:
Marketplace
Services
Other
Total revenue
Cost of revenue
Gross profit
Operating expenses:
Marketing
Product development
General and administrative
Asset impairment charges
Total operating expenses
Income from operations
Other (expense) income, net
Income (loss) before income taxes
Benefit (provision) for income taxes
Net income (loss)
Year Ended
December 31,
2018
2017
2016
(in thousands)
$
440,740
$
326,076
$
158,928
4,025
603,693
190,762
412,931
158,013
97,249
82,883
—
338,145
74,786
(19,708)
55,078
22,413
111,869
3,286
441,231
150,986
290,245
109,085
74,616
91,486
3,162
278,349
11,896
20,369
32,265
49,535
$
77,491
$
81,800
$
269,628
89,433
5,906
364,967
123,328
241,639
82,248
55,083
86,180
551
224,062
17,577
(20,453)
(2,876)
(27,025)
(29,901)
Year Ended
December 31,
2018
2017
2016
73.0%
73.9%
73.9 %
26.3
0.7
100.0
31.6
68.4
26.2
16.1
13.7
—
56.0
12.4
(3.3)
9.1
3.7
12.8%
25.4
0.7
100.0
34.2
65.8
24.7
16.9
20.7
0.7
63.1
2.7
4.6
7.3
11.2
18.5%
24.5
1.6
100.0
33.8
66.2
22.5
15.1
23.6
0.2
61.4
4.8
(5.6)
(0.8)
(7.4)
(8.2)%
67
Comparison of Years Ended December 31, 2018 and 2017
Revenue
Revenue:
Marketplace
Percentage of total revenue
Services
Percentage of total revenue
Other
Percentage of total revenue
Total revenue
Year Ended
December 31,
Change
2018
2017
$
%
(in thousands except percentages)
$
$
$
$
440,740
73.0%
158,928
26.3%
4,025
0.7%
603,693
$
$
$
$
326,076
73.9%
111,869
25.4%
3,286
0.7%
441,231
$
$
$
$
114,664
47,059
739
162,462
35.2%
42.1%
22.5%
36.8%
GMS increased $678.1 million, or 20.8%, to $3.9 billion in the year ended December 31, 2018 compared to the year ended
December 31, 2017. On a currency-neutral basis (excluding the direct impact of currency translation on GMS from goods that
are not listed in U.S. dollars) GMS growth for the year ended December 31, 2018 would have been 20.4%, or approximately 40
basis points lower than the reported 20.8% growth. Supporting this growth in GMS, active sellers increased 9.4% to 2.1 million
and active buyers increased 18.2% to 39.4 million at December 31, 2018 compared to December 31, 2017. In the year ended
December 31, 2018, GMS from new buyers grew 16% year-over-year and represented approximately 18% of overall GMS, a
decrease compared to last year. In the year ended December 31, 2018, GMS from existing buyers grew 23% year-over-year and
represented approximately 82% of overall GMS, an increase compared to last year. We anticipate continued visit growth and
improved conversion in 2019. We believe conversion improvements will be driven primarily by product launches enhancing the
buyer experience.
During the year ended December 31, 2018, mobile GMS increased as a percentage of total GMS to approximately 55%, up
from approximately 51% for the year ended December 31, 2017. We believe this increase was a result of increased mobile
traffic, and, to a lesser extent, continued improvements in our mobile offerings for Etsy buyers. Mobile GMS growth during the
year ended December 31, 2018 was approximately 30%, with mobile web and mobile app GMS each continuing to grow faster
than desktop GMS during the year.
For the year ended December 31, 2018, international GMS increased as a percentage of total GMS to 35%, up from
approximately 33% for the year ended December 31, 2017. International GMS was up approximately 28% in the year ended
December 31, 2018 compared to the year ended December 31, 2017, driven by GMS between U.S. buyers and international
sellers and by our fastest growing international trade route, international domestic, which is GMS generated between a non-
U.S. buyer and a non-U.S. seller both in the same country. International domestic GMS grew approximately 36% in 2018
compared with 2017. On a currency-neutral basis international GMS growth for the year ended December 31, 2018 would have
been 27%. We expect international GMS to continue to grow faster than U.S. GMS, assuming that currency rates remain stable
compared to average levels in December 2018, driven by our global product enhancements and marketing.
Revenue increased $162.5 million, or 36.8%, to $603.7 million in the year ended December 31, 2018 compared to the year
ended December 31, 2017, of which 73.0% consisted of Marketplace revenue and 26.3% consisted of Services revenue.
Marketplace revenue increased $114.7 million, or 35.2%, to $440.7 million in the year ended December 31, 2018 compared to
the year ended December 31, 2017. This growth corresponded with a 20.8% increase in GMS to a total of $3.9 billion for the
year ended December 31, 2018. Marketplace revenue increased at a faster rate than GMS primarily due to the increase in
transaction revenue and Etsy Payments revenue for the year ended December 31, 2018 compared to the year ended December
31, 2017. Transaction revenue increased 59.6% year-over-year, primarily driven by our 2018 pricing updates, which drove
approximately 41% of the 59.6% increase. Etsy Payments revenue increased 24.4%, largely driven by overall GMS growth
trends and increased seller adoption. The share of GMS processed through our Etsy Payments platform was 86% for the year
ended December 31, 2018, up from 85% for the year ended December 31, 2017, primarily due to the transition of sellers in
eligible countries to the platform. During the second quarter of 2018, we reached the anniversary of the Etsy Payments
adoption requirement, which has been a substantial driver of year-over-year Etsy Payments revenue growth, and therefore, we
expect Etsy Payments to grow more closely in-line with year-over-year GMS growth in future quarters. Listing fee revenue
grew 17.0%, driven by an increase in charged listings year-over-year corresponding with the increase in overall GMS growth.
68
Listing fee revenue increased at a slower rate than GMS primarily due to the issuance of free listings in our international
markets, including France and Germany.
Services revenue increased $47.1 million, or 42.1%, to $158.9 million in the year ended December 31, 2018 compared to the
year ended December 31, 2017. The growth in Services revenue was primarily driven by an increase in Promoted
Listings, up 41.4%, and, to a lesser extent, Etsy Shipping Labels, up 39.9%. The increase in Promoted Listings revenue was due
to higher click volume and overall product enhancements, including expansion of Promoted Listing budgets and context
specific ranking on Promoted Listings, which increased the relevance of promoted ads in our search results. The increase in
Etsy Shipping Label revenue was primarily driven by a combination of an increase in label volume and an increase in average
margin per label. Additionally, Etsy Shipping Label revenue reflects a one-time adjustment to recognize prior period revenue
which drove $2.8 million of the increase. At December 31, 2018, 15.1% of active sellers used Promoted Listings, and 24.7% of
active sellers in the United States, Canada, United Kingdom, and Australia used Etsy Shipping Labels.
Cost of Revenue
Cost of revenue
Percentage of total revenue
Year Ended
December 31,
Change
2018
2017
$
%
$
190,762
$
150,986
$
39,776
26.3%
(in thousands except percentages)
31.6%
34.2%
Cost of revenue increased $39.8 million, or 26.3%, to $190.8 million in the year ended December 31, 2018 compared to the
year ended December 31, 2017, primarily driven by additional costs as a result of the increase in transactions and related
revenue generated on the Etsy platform. The remaining increase was driven by hosting and bandwidth costs incurred as a result
of our migration to the cloud while also maintaining our current infrastructure, and, to a lesser extent, increases in employee-
related and professional services expenses. Cost of revenue decreased as a percentage of revenue largely due to 2018 changes
in our pricing.
Operating Expenses
There were a total of 874 employees on December 31, 2018, compared with 744 on December 31, 2017.
Marketing
Year Ended
December 31,
Change
2018
2017
$
%
(in thousands except percentages)
Marketing
$
158,013
$
109,085
$
48,928
44.9%
Percentage of total revenue
26.2%
24.7%
Marketing expenses increased $48.9 million, or 44.9%, to $158.0 million in the year ended December 31, 2018 compared to the
year ended December 31, 2017, primarily as a result of increased spend on digital marketing related to buyer acquisition, and,
to a lesser extent, increased direct marketing expenses associated with our television ad campaigns. These increases were offset
by decreases in employee-related expenses due to a reduction in average headcount and $3.0 million of restructuring and other
exit costs associated with the Actions included in marketing expense for the year ended December 31, 2017 that did not recur in
2018. Excluding the impact of restructuring and other exit costs, non-GAAP marketing expenses increased $52.0 million,
or 49.0%. In 2019, we expect to increase our investment in marketing, including into channels such as television.
69
Product development
Product development
Percentage of total revenue
Year Ended
December 31,
Change
2018
2017
$
%
$
97,249
$
74,616
$
22,633
30.3%
(in thousands except percentages)
16.1%
16.9%
Product development expenses increased $22.6 million, or 30.3%, to $97.2 million in the year ended December 31, 2018
compared to the year ended December 31, 2017, primarily as a result of an increase in employee-related expenses, including
stock-based compensation, and professional services expenses for consultants working on our product and engineering teams.
The increase in employee-related expenses includes approximately $8.5 million of expense in connection with certain
employee departures, including $7.0 million in expense resulting from the modification of stock options and RSUs.
Additionally, $3.2 million of restructuring and other exit costs associated with the Actions is included in product development
expenses for the year ended December 31, 2017. Excluding the impact of restructuring and other exit costs, non-GAAP product
development expenses increased $26.0 million, or 36.4%.
General and administrative
General and administrative
Percentage of total revenue
Year Ended
December 31,
Change
2018
2017
$
%
$
82,883
$
91,486
$
(8,603)
(9.4)%
(in thousands except percentages)
13.7%
20.7%
General and administrative expenses decreased $8.6 million, or 9.4%, to $82.9 million in the year ended December 31, 2018
compared to the year ended December 31, 2017, primarily due to decreased employee-related expenses, including stock-based
compensation, mainly the result of a reduction in average headcount and $7.0 million of restructuring and other exit costs
associated with the Actions included in general and administrative expenses for the year ended December 31, 2017 that did not
recur in 2018. Excluding the impact of restructuring and other exit costs, non-GAAP general and administrative expenses
decreased $1.6 million, or 1.9%. Upon adoption of ASU 2016-02, Leases in 2019, we expect to recognize additional
depreciation and amortization expense compared to the year ended December 31, 2018 related to the accounting treatment for
our Brooklyn headquarters lease.
Asset impairment charges
Year Ended
December 31,
Change
2018
2017
$
%
(in thousands except percentages)
Asset impairment charges
Percentage of total revenue
$
— $
—%
3,162
$
(3,162)
(100.0)%
0.7%
There were no asset impairment charges in the year ended December 31, 2018. Asset impairment charges were $3.2 million in
the year ended December 31, 2017. In the fourth quarter of 2017, we made the decision to discontinue certain product
offerings, including Etsy Studio and Etsy Manufacturing, which resulted in the recognition of a $3.2 million impairment charge
to write the related capitalized web development and internal-use software assets down to zero. This decision was based on our
strategy to focus on the growth of the Etsy.com marketplace.
70
Other (Expense) Income, net
Other (expense) income, net:
Interest expense
Percentage of total revenue
Interest and other income
Percentage of total revenue
Foreign exchange (loss) gain
Percentage of total revenue
Other (expense) income, net
Percentage of total revenue
Year Ended
December 31,
Change
2018
2017
$
%
(in thousands except percentages)
$
$
$
$
(22,178)
(3.7)%
8,957
1.5 %
(6,487)
(1.1)%
(19,708)
(3.3)%
$
$
$
$
(11,130)
(2.5)%
2,394
0.5 %
29,105
6.6 %
20,369
4.6 %
$
$
$
$
(11,048)
99.3 %
6,563
274.1 %
(35,592)
(122.3)%
(40,077)
(196.8)%
Other expense, net was $19.7 million in the year ended December 31, 2018, which increased $40.1 million from other income,
net of $20.4 million in the year ended December 31, 2017. The increase in expense was primarily driven by the change in U.S.
Dollar to Euro exchange rates on our intercompany and other non-functional currency balances, and higher interest expense,
mainly non-cash interest related to our convertible debt issued in the first quarter of 2018, partially offset by increased interest
and dividend income related to our investment accounts. Interest expense also includes non-cash interest expense associated
with the build-to-suit lease accounting related to our corporate headquarters, which remained flat year-over-year. Upon
adoption of ASU 2016-02, Leases in 2019, we expect to recognize decreased interest expense compared to the year ended
December 31, 2018 related to the accounting treatment for our Brooklyn headquarters lease.
Benefit for Income Taxes
Benefit for income taxes
Percentage of total revenue
Year Ended
December 31,
Change
2018
2017
$
%
$
22,413
$
49,535
$
(27,122)
(54.8)%
(in thousands except percentages)
3.7%
11.2%
Our income tax benefit for the years ended December 31, 2018 and 2017 was $22.4 million and $49.5 million, respectively.
The primary drivers of our income tax benefit for the year ended December 31, 2018 were tax benefit related to valuation
allowance of $28.7 million, stock-based compensation of $11.7 million, and our research and development tax credit of $4.1
million. These were partially offset by tax expense related to income before income taxes of $11.3 million, state and local tax
expense of $3.8 million, and the inclusion of additional taxes of $3.9 million due to certain provisions of the Tax Cuts and Jobs
Act of 2017, as enacted by the U.S. Federal Government on December 22, 2017, (the “TCJA”).
The primary driver of our income tax benefit for the year ended December 31, 2017 was the impact on deferred taxes from the
reduction in the U.S. federal corporate tax rate beginning in 2018. As a result of the TCJA, which reduced the corporate income
tax rate from 35% to 21%, our deferred taxes and certain unrecognized tax benefits at December 31, 2017 have been revalued
at the reduced 21% rate. The revaluation resulted in a benefit for income taxes of approximately $31.1 million for the year
ended December 31, 2017.
The secondary driver of the income tax benefit for the year ended December 31, 2017 was the recognition of excess tax
benefits from stock-based compensation as a result of the adoption of ASU 2016-09—Stock Compensation: Improvements to
Employee Share-based Payment Accounting in the first quarter of 2017. As a result of this updated guidance, we recorded $12.8
million of excess tax benefits, rather than additional paid-in capital, for the year ended December 31, 2017.
For both periods, other drivers include the mix of income and losses in jurisdictions with a wide range of tax rates, the
disallowance of the benefit of losses in certain foreign jurisdictions and the amount of non-deductible stock-based
compensation expense.
71
Comparison of Years Ended December 31, 2017 and 2016
Revenue
Revenue:
Marketplace
Percentage of total revenue
Services
Percentage of total revenue
Other
Percentage of total revenue
Total revenue
Year Ended
December 31,
Change
2017
2016
$
%
(in thousands except percentages)
$
$
$
$
326,076
73.9%
111,869
25.4%
3,286
0.7%
441,231
$
$
$
$
269,628
73.9%
89,433
24.5%
5,906
1.6%
364,967
$
$
$
$
56,448
20.9 %
22,436
25.1 %
(2,620)
(44.4)%
76,264
20.9 %
GMS increased $411.6 million, or 14.5%, to $3.3 billion in the year ended December 31, 2017 compared to the year ended
December 31, 2016. On a currency-neutral basis (excluding the direct impact of currency translation on GMS from goods that
are not listed in U.S. dollars) GMS growth for the year ended December 31, 2017 would have been 14.3%, or approximately 20
basis points lower than the reported 14.5% growth. Supporting this growth in GMS, active sellers increased 10.6% to 1.9
million and active buyers increased 16.8% to 33.4 million at December 31, 2017 compared to December 31, 2016. In the year
ended December 31, 2017, GMS from new buyers increased 13% year-over-year and represented approximately 19% of overall
GMS, a slight decrease compared to last year. In the year ended December 31, 2017, GMS from existing buyers increased 16%
year-over-year and represented approximately 81% of overall GMS, a slight increase compared to last year.
During the year ended December 31, 2017, mobile GMS increased as a percentage of total GMS to approximately 51%, up
from approximately 48% for the year ended December 31, 2016. We believe this increase was a result of increased mobile
traffic, and, to a lesser extent, continued improvements in our mobile offerings for Etsy buyers. Mobile web continued to be the
largest driver of mobile GMS growth. Mobile GMS growth during the year ended December 31, 2017 was approximately 22%,
with mobile web and mobile app GMS each continuing to grow faster than desktop GMS during the year. Year-over-year,
mobile conversion rates continued to grow faster than desktop conversion rates.
For the year ended December 31, 2017, international GMS increased as a percentage of total GMS to 33%, from 30% for the
year ended December 31, 2016, largely driven by continued GMS growth between U.S. buyers and international sellers, and
buyers and sellers outside of the U.S., both in the same country and cross-border. GMS growth between international buyers
and sellers in the same country was the fastest growing category of international GMS, up approximately 45% year-over-year
during the year ended December 31, 2017 compared to the year ended December 31, 2016. International GMS was up
approximately 23% in the year ended December 31, 2017 compared to the year ended December 31, 2016, growing faster than
overall GMS.
Revenue increased $76.3 million, or 20.9%, to $441.2 million in the year ended December 31, 2017 compared to the year
ended December 31, 2016, of which 73.9% consisted of Marketplace revenue and 25.4% consisted of Services revenue.
Marketplace revenue increased $56.4 million, or 20.9%, to $326.1 million in the year ended December 31, 2017 compared to
the year ended December 31, 2016. This growth corresponded with a 14.5% increase in GMS to a total of $3.3 billion in the
year ended December 31, 2017. Marketplace grew at a faster rate than GMS primarily due to the increase in Etsy Payments, up
31.6%, largely driven by overall GMS growth trends and increased seller adoption. The share of GMS processed through our
Etsy Payments platform was 85%, for the year ended December 31, 2017, up from 78% in the year ended December 31, 2016,
primarily due to the transition of nearly all sellers in eligible countries to the platform. Transaction fee revenue grew 14.1% and
listing fee revenue grew 12.3%, driven by overall GMS trends. Listing fee revenue grew at a slower rate than GMS primarily
due to the issuance of free listings for promotional activities focused on driving growth in our international markets in the
second half of 2017, including listings granted for the transition of our ALM sellers to the Etsy marketplace.
Services revenue increased $22.4 million, or 25.1%, to $111.9 million in the year ended December 31, 2017 compared to the
year ended December 31, 2016. The growth in Services revenue was primarily driven by an increase in revenue from Promoted
Listings, up 25.0%, and, to a lesser extent, Etsy Shipping Labels, up 16.7%, and Pattern, up 84.8%. The increase in Promoted
Listings revenue was due to higher click volume and overall product enhancements. The increase in Etsy Shipping Label
72
revenue reflects a combination of an increase in label volume and average margin per label. The increase in Pattern revenue
was primarily due to the incremental monthly paid subscription periods in 2017, as the product launched in April 2016, with the
first paid subscriptions beginning in May 2016. At December 31, 2017, 15.0% of active sellers used Promoted Listings, and
28.1% of active sellers in the United States and Canada used Etsy Shipping Labels.
Other revenue decreased $2.6 million, or 44.4%, to $3.3 million in the year ended December 31, 2017 compared to the year
ended December 31, 2016, mainly due to a decrease in revenue from accumulated unused gift card funds received from our
third-party service provider, down 73.4%. In the year ended December 31, 2016, we recognized $1.7 million in revenue from
accumulated unused gift cards, which represented the three-year cumulative value of gift cards that the third-party service
provider has concluded are not likely to be redeemed. In 2017, unused gift card revenue was recognized monthly as earned and
is not anticipated to be significant in future periods. In addition, processing fees from PayPal, a third-party payment processor,
decreased 30.2% as a result of the transition of nearly all sellers in eligible countries to Etsy Payments in 2017.
Cost of Revenue
Cost of revenue
Percentage of total revenue
Year Ended
December 31,
Change
2017
2016
$
%
$
150,986
$
123,328
$
27,658
22.4%
(in thousands except percentages)
34.2%
33.8%
Cost of revenue increased $27.7 million, or 22.4%, to $151.0 million in the year ended December 31, 2017 compared to the
year ended December 31, 2016, primarily as a result of additional costs to support the increase in Etsy Payments revenue and,
to a lesser extent, an increase in employee-related costs. Cost of revenue increased as a percentage of revenue primarily due to
an increase in professional services expenses related to customer service support. Restructuring and other exit costs of $0.7
million associated with the Actions were included in cost of revenue for the year ended December 31, 2017.
Operating Expenses
There were a total of 744 employees on December 31, 2017, compared with 1,043 on December 31, 2016, reflecting headcount
reductions associated with the Actions.
Marketing
Year Ended
December 31,
Change
2017
2016
$
%
(in thousands except percentages)
Marketing
$
109,085
$
82,248
$
26,837
32.6%
Percentage of total revenue
24.7%
22.5%
Marketing expenses increased $26.8 million, or 32.6%, to $109.1 million in the year ended December 31, 2017 compared to the
year ended December 31, 2016, primarily as a result of increased spend on digital marketing related to buyer acquisition, and
an increase in employee-related expenses in our marketing team, including $3.0 million of restructuring and other exit costs
associated with the Actions.
73
Product development
Product development
Percentage of total revenue
Year Ended
December 31,
Change
2017
2016
$
%
$
74,616
$
55,083
$
19,533
35.5%
(in thousands except percentages)
16.9%
15.1%
Product development expenses increased $19.5 million, or 35.5%, to $74.6 million in the year ended December 31, 2017
compared to the year ended December 31, 2016, primarily as a result of an increase in employee-related expenses in our
product and engineering teams, up $10.3 million, including $3.2 million of restructuring and other exit costs associated with the
Actions, and $6.2 million of additional expenses resulting from the acquisition of Blackbird in September 2016.
General and administrative
General and administrative
Percentage of total revenue
Year Ended
December 31,
Change
2017
2016
$
%
$
91,486
$
86,180
$
5,306
6.2%
(in thousands except percentages)
20.7%
23.6%
General and administrative expenses increased $5.3 million, or 6.2%, to $91.5 million in the year ended December 31, 2017
compared to the year ended December 31, 2016, primarily driven by an increase in employee-related expenses, including $7.0
million of restructuring and other exit costs associated with the Actions. This increase was partially offset by decreases in
professional services and office overhead expenses.
Asset impairment charges
Year Ended
December 31,
Change
2017
2016
$
%
(in thousands except percentages)
Asset impairment charges
Percentage of total revenue
$
3,162
$
0.7%
551
$
0.2%
2,611
473.9%
Asset impairment charges increased $2.6 million, or 473.9%, to $3.2 million in the year ended December 31, 2017, compared
to the year ended December 31, 2016. In the fourth quarter of 2017, we made the decision to discontinue certain product
offerings, including Etsy Studio and Etsy Manufacturing, which resulted in the recognition of a $3.2 million impairment charge
to write the related capitalized web development and internal-use software assets down to zero. This decision was based on our
strategy to focus on the growth of the Etsy.com marketplace. This compares to $0.6 million in the year ended December 31,
2016, related to the impairment of nonrecoverable intangible assets acquired in the ALM and Jarvis Labs, Inc. acquisitions for
customer relationships and trademarks.
74
Other Income (Expense), net
Other income (expense), net:
Interest expense
Percentage of total revenue
Interest and other income
Percentage of total revenue
Foreign exchange gain (loss)
Percentage of total revenue
Other income (expense), net
Percentage of total revenue
Year Ended
December 31,
Change
2017
2016
$
%
(in thousands except percentages)
$
$
$
$
(11,130)
(2.5)%
2,394
0.5 %
29,105
6.6 %
20,369
4.6 %
$
$
$
$
(7,204)
(2.0)%
1,702
0.5 %
(14,951)
(4.1)%
(20,453)
(5.6)%
$
$
$
$
(3,926)
54.5 %
692
40.7 %
44,056
(294.7)%
40,822
(199.6)%
Other income, net was $20.4 million in the year ended December 31, 2017, which increased $40.8 million from other expense,
net of $20.5 million in the year ended December 31, 2016. The increase in income was primarily driven by the change in U.S.
Dollar to Euro exchange rates on our intercompany and other non-functional currency balances, partially offset by an increase
in interest expense, largely associated with the build-to-suit lease accounting related to our corporate headquarters. In the fourth
quarter of 2017, we established a new legal entity based in Ireland with a U.S. dollar functional currency to help mitigate the
currency rate risk on our intercompany debt.
Benefit (Provision) for Income Taxes
Benefit (provision) for income taxes
Percentage of total revenue
Year Ended
December 31,
Change
2017
2016
$
%
$
49,535
$
(27,025)
$
76,560
283.3%
(in thousands except percentages)
11.2%
(7.4)%
Our income tax benefit and provision for the years ended December 31, 2017 and 2016 was $49.5 million and $27.0 million,
respectively.
The primary driver of the income tax benefit for the year ended December 31, 2017 was the impact on deferred taxes from the
reduction in the U.S. federal corporate tax rate beginning in 2018. On December 22, 2017 the TCJA was signed into law,
which, among other items, reduced the corporate income tax rate from 35% to 21%. As a result, our deferred taxes and certain
unrecognized tax benefits at December 31, 2017 have been revalued at the reduced 21% rate. The revaluation resulted in a
benefit for income taxes of approximately $31.1 million for the year ended December 31, 2017.
The secondary driver of the income tax benefit for the year ended December 31, 2017 was the recognition of excess tax
benefits from stock-based compensation as a result of the adoption of ASU 2016-09—Stock Compensation: Improvements to
Employee Share-based Payment Accounting in the first quarter of 2017. As a result of this updated guidance, we recorded $12.8
million of excess tax benefits, rather than additional paid-in capital, for the year ended December 31, 2017.
The primary driver of the income tax provision for the year ended December 31, 2016 was tax expense related to our updated
corporate structure of $17.1 million.
For both periods, other drivers include the mix of income and losses in jurisdictions with a wide range of tax rates, the
disallowance of the benefit of losses in certain foreign jurisdictions and the amount of non-deductible stock-based
compensation expense.
75
Cost of revenue (3)(4)
Gross profit
Operating expenses:
Marketing (3)(4)
Product development (3)
(4)
General and
administrative (3)(4)
Total operating
expenses
Income (loss) from operations
Other (expense) income, net
Income (loss) before income
taxes
Benefit (provision) for income
taxes (5)
Quarterly Results of Operations
The following tables show selected unaudited quarterly results of operations and other unaudited operational and non-GAAP
financial data for the eight quarters ended December 31, 2018 and the percentage that each line item in the following results of
operations data represents of revenue. The results of operations data for each of these quarters have been prepared on the same
basis as the audited annual Consolidated Financial Statements included elsewhere in this Annual Report on Form 10-K and
includes all adjustments, which include only normal recurring adjustments, necessary for the fair statement of our results of
operations for these periods. This data should be read in conjunction with our Consolidated Financial Statements and related
notes included elsewhere in this Annual Report. Our quarterly results of operations and operational and non-GAAP financial
data will vary in the future. These quarterly operating results are not necessarily indicative of our operating results for any
future quarter or year.
Dec. 31,
2018 (1)
Sept. 30,
2018
June 30,
2018
Mar. 31,
2018
Dec. 31,
2017
Sept. 30,
2017
June 30,
2017
Mar. 31,
2017
(in thousands except share and per share amounts)
Three Months Ended
Revenue:
Marketplace (2)
Services (2)
Other
$
150,540 $
110,927 $
91,306 $
87,967 $
102,261 $
77,808 $
75,445 $
48,622
866
38,194
1,245
39,507
1,574
32,605
34,309
27,976
25,440
340
(302)
596
807
Total revenue
200,028
150,366
132,387
120,912
136,268
106,380
101,692
57,111
46,947
142,917
103,419
45,409
86,978
41,295
79,617
44,220
92,048
36,383
69,997
35,724
65,968
70,562
24,144
2,185
96,891
34,659
62,232
63,362
39,516
28,941
26,194
34,590
23,520
27,521
23,454
28,542
24,418
23,568
20,721
17,788
16,958
21,754
18,116
Asset impairment charges
—
—
—
—
21,524
20,748
21,707
18,904
18,218
3,162
22,094
28,411
22,763
—
—
—
113,428
84,682
74,216
65,819
73,758
62,572
77,686
64,333
29,489
(6,613)
18,737
(4,141)
12,762
(8,137)
13,798
18,290
(817)
(24)
7,425
5,815
(11,718)
13,950
(2,101)
628
22,876
14,596
4,625
12,981
18,266
13,240
2,232
(1,473)
Net income (loss)
$
41,251 $
19,894 $
3,379 $
12,967 $
44,750 $
25,802 $
11,669 $
Net income (loss) per share attributable to common stockholders:
18,375
5,298
(1,246)
(14)
26,484
12,562
9,437
1,052
(421)
Basic
Diluted
$
$
0.34 $
0.32 $
0.17 $
0.15 $
0.03 $
0.03 $
0.11 $
0.10 $
0.37 $
0.36 $
0.22 $
0.21 $
0.10 $
0.10 $
0.00
0.00
Weighted average common shares outstanding:
Basic
Diluted
120,192,91
2
119,870,71
1
119,450,19
4
121,267,09
2
121,586,99
1
119,592,19
1
116,933,21
6
115,696,02
4
129,012,50
8
129,086,13
7
125,551,75
9
125,772,31
5
124,818,32
2
123,224,55
9
120,723,93
8
115,696,02
4
(1) During the three months ended December 31, 2018, we recorded adjustments to correct errors in the years ended
December 31, 2018 and 2017 that increased income before income taxes by $1.6 million in the current quarter and
decreased net income by $1.8 million in the current quarter. The Company has concluded that the errors and their
correction were not material to the Consolidated Financial Statements for any of the periods impacted nor are they
material for results in the fourth quarter of 2018.
76
(2) In connection with the adoption of ASU 2014-09—Revenue from Contracts with Customers (“ASC 606”) in the first
quarter of 2018, we renamed our revenue categories Marketplace and Services revenue. In addition, we reclassified Etsy
Payments from Services to Marketplace revenue as described in “Note 2—Revenue.” The following table provides our
Marketplace and Services revenue under our previous and current presentation:
Previous Presentation
Updated Presentation
Marketplace Revenue
Services Revenue
Marketplace Revenue
Services Revenue
Quarter-to-Date Period Ended
$
54,251
$
82,319
$
102,261
$
(in thousands)
42,413
42,069
40,759
63,371
58,816
53,947
77,808
75,445
70,562
34,309
27,976
25,440
24,144
December 31, 2017
September 30, 2017
June 30, 2017
March 31, 2017
(3) Includes total stock-based compensation expense as follows:
Dec. 31,
2018
Sept. 30,
2018
June 30,
2018
Mar. 31,
2018
Dec. 31,
2017
Sept. 30,
2017
June 30,
2017
Mar. 31,
2017
Three Months Ended
(in thousands)
Cost of revenue
$
990 $
894 $
927 $
546 $
508 $
469 $
398 $
688
9,873
2,693
642
4,697
2,683
699
4,025
2,966
478
2,639
2,791
514
2,021
2,948
447
2,180
4,425
528
2,053
5,183
364
444
2,020
2,057
Marketing
Product development (a)
General and administrative
Total stock-based
compensation expense
$
14,244 $
8,916 $
8,617 $
6,454 $
5,991 $
7,521 $
8,162 $
4,885
(a)
Product development includes $6.0 million and $1.0 million of expense resulting from the modification of stock
options and RSUs in the three months ended December 31, 2018 and September 30, 2018, respectively, in
connection with certain employee departures See “Note 16—Stock-based Compensation” in the Notes to
Consolidated Financial Statements for additional information.
(4) Includes restructuring and other exit costs (income), as shown in the quarterly reconciliation of net income (loss) to
Adjusted EBITDA below. For a summary of restructuring and other exit costs (income) see “Note 17—Restructuring
and Other Exit Costs (Income)” in the Notes to Consolidated Financial Statements.
(5) In the year ended December 31, 2018, we recognized an income tax benefit associated with the release of a valuation
allowance on certain deferred tax assets. The valuation allowance release resulted in a non-recurring benefit for income
taxes of $23.4 million for the year ended December 31, 2018. In the quarter ended December 31, 2017, we recognized
an income tax benefit associated with the enactment of the TCJA as defined above. As a result of the TCJA, our deferred
taxes at December 31, 2017 have been revalued at the reduced 21% corporate income tax rate. The revaluation resulted
in a non-recurring benefit for income taxes of approximately $31.1 million for the quarter ended December 31, 2017.
77
Revenue:
Marketplace
Services
Other
Total revenue
Cost of revenue
Gross profit
Operating expenses:
Marketing
Product development
General and
administrative
Asset impairment charges
Total operating
expenses
Income (loss) from operations
Other (expense) income, net
Income (loss) before income
taxes
Benefit (provision) for income
taxes
Net income (loss)
Dec. 31,
2018
Sept. 30,
2018
June 30,
2018
Mar. 31,
2018
Dec. 31,
2017
Sept. 30,
2017
June 30,
2017
Mar. 31,
2017
Three Months Ended
75.3%
73.8%
69.0%
72.8%
73.1%
74.2%
72.8 %
24.3
0.4
100.0
28.6
71.4
31.7
14.3
10.8
—
56.7
14.7
(3.3)
11.4
9.2
20.6%
25.4
0.8
100.0
31.2
68.8
26.3
16.2
13.8
—
56.3
12.5
(2.8)
9.7
3.5
13.2%
29.8
1.2
100.0
34.3
65.7
21.9
17.8
16.4
—
56.1
9.6
(6.1)
3.5
(0.9)
2.6%
27.0
0.3
100.0
34.2
65.8
21.7
17.1
15.6
—
54.4
11.4
(0.7)
10.7
75.0%
25.2
(0.2)
100.0
32.5
67.5
25.4
13.1
13.4
2.3
54.1
13.4
—
13.4
26.3
0.6
100.0
34.2
65.8
22.1
15.9
20.8
—
58.8
7.0
5.5
12.4
25.0
0.8
100.0
35.1
64.9
27.1
21.4
27.9
—
76.4
(11.5)
13.7
2.2
9.3
24.9
2.3
100.0
35.8
64.2
24.2
18.7
23.5
—
66.4
(2.2)
0.6
(1.5)
1.1
11.5%
(0.4)%
—
10.7%
19.4
32.8%
11.8
24.3%
Dec. 31,
2018
Sept. 30,
2018
June 30,
2018
Mar. 31,
2018
Dec. 31,
2017
Sept. 30,
2017
June 30,
2017
Mar. 31,
2017
(in thousands except percentages)
Three Months Ended
Other financial and operations data (1):
GMS
GMS growth
Currency-neutral GMS
growth
Adjusted EBITDA
Active sellers
Active buyers
$1,246,472
$ 922,513
$ 901,685
$ 861,075
$1,019,452
$ 766,354
$ 748,762
$ 719,041
22.3%
20.4%
20.4%
19.8%
17.8%
13.2%
11.8%
14.2%
23.1%
20.8%
19.3%
17.6%
16.5%
12.6%
12.6%
15.2%
$
51,359
$
34,035
$
27,695
$
26,421
$
34,822
$
22,769
$
12,696
$
2,115
39,447
2,043
37,134
1,983
35,830
1,970
34,693
1,933
33,364
1,891
31,680
1,834
30,584
9,722
1,801
29,669
Percent mobile GMS
Percent international GMS
56%
36%
56%
35%
55%
34%
54%
35%
52%
33%
52%
34%
51%
32%
51%
32%
(1) See “Key Operating and Financial Metrics” for the definitions of the following terms: “active buyer,” “active seller,”
“Adjusted EBITDA,” “GMS,” “international GMS,” and “mobile GMS.”
78
The following table reflects the reconciliation of net income (loss) to Adjusted EBITDA for each of the periods indicated:
Dec. 31,
2018
Sept. 30,
2018
June 30,
2018
Mar. 31,
2018
Dec. 31,
2017
Sept. 30,
2017
June 30,
2017
Mar. 31,
2017
Three Months Ended
(in thousands)
$
41,251 $
19,894 $
3,379 $
12,967 $
44,750 $
25,802 $
11,669 $
(421)
3,099
3,768
3,687
2,667
2,177
2,254
2,153
2,152
(18,375)
(5,298)
1,246
14
(26,484)
(12,562)
(9,437)
(1,052)
7,626
6,439
6,357
6,320
6,577
7,022
6,660
6,938
12,648
8,191
7,898
5,740
5,197
5,832
4,881
4,043
1,596
3,514
—
—
725
373
(57)
—
719
714
725
724
1,613
842
4,450
(1,850)
(2,153)
(8,069)
(16,103)
(2,780)
(41)
—
(151)
871
1,766
11,260
—
3,162
—
—
—
—
Net income (loss)
Excluding:
Interest and other non-
operating expense, net
(Benefit) provision for
income taxes
Depreciation and
amortization
Stock-based
compensation
expense(1)
Stock-based
compensation expense
—acquisitions
Foreign exchange loss
(gain)
Restructuring and other
exit costs (income)
Asset impairment
charges (2)
Adjusted EBITDA
$
51,359 $
34,035 $
27,695 $
26,421 $
34,822 $
22,769 $
12,696 $
9,722
(1) $0.1 million, $1.0 million, and $1.7 million of restructuring-related stock-based compensation expense has been
excluded from the three months ended December 31, 2017, September 30, 2017, and June 30, 2017, respectively, and is
included in the restructuring and other exit costs (income) line.
(2) In the fourth quarter of 2017, we made the decision to discontinue certain product offerings, including Etsy Studio and
Etsy Manufacturing, which resulted in the recognition of a $3.2 million impairment charge to write the related
capitalized web development and internal-use software assets down to zero. This decision was based on our strategy to
focus on the growth of the Etsy.com marketplace.
Seasonality
Etsy sellers experience increased sales and use more Services during the fourth-quarter holiday shopping season. This has
resulted in increased GMS and revenue for us during the fourth quarter of each fiscal year, which can compare to lower GMS
and revenue in the first quarter of the following fiscal year. For example, revenue in the first quarter of 2018 decreased when
compared with revenue in the fourth quarter of 2017. We expect this seasonality to continue in future years. Our cost of revenue
and marketing expenses also follow this trend, with the highest costs corresponding with the fourth quarter and lower costs in
the first quarter of each fiscal year. As our growth rates moderate, the impact of these seasonality trends on our results of
operations may become more pronounced.
Our quarterly revenue increased sequentially quarter-to-quarter for all periods presented above, other than the first quarter of
2018, corresponding to our GMS performance in the same periods. We cannot assure you that this pattern of sequential revenue
and GMS growth will continue. We believe that it is generally more meaningful to compare year-over-year results than
sequential quarter-over-quarter results.
79
Liquidity and Capital Resources
The following tables show our cash and cash equivalents, short-term investments, accounts receivable and net working capital
as of the dates indicated:
Cash and cash equivalents
Short-term investments
Accounts receivable, net
Net working capital
As of December 31,
2018
2017
(in thousands)
$
366,985
$
257,302
12,244
568,227
315,442
25,108
33,677
336,787
As of December 31, 2018, our cash and cash equivalents, a majority of which were held in cash deposits and money market
funds, were held in the United States for future investments, working capital funding, and general corporate purposes.
We invest in short-term instruments, including fixed-income funds and U.S. Government and agency securities aligned with
our investment strategy. These investments are intended to allow us to preserve our principal, maintain the ability to meet our
liquidity needs, deliver positive yields across a balanced portfolio, and continue to provide us with direct fiduciary control. In
accordance with our investment policy, all investments have maturities no longer than 36 months, with the average maturity of
these investments maintained at 12 months or less.
Sources of Liquidity
In March 2018, we issued $345.0 million aggregate principal amount of 0% Convertible Senior Notes due 2023 (the “Notes”)
in a private placement to qualified institutional buyers pursuant to Rule 144A under the Securities Act. The initial conversion
price of the Notes represented a premium of approximately 37.5% over the price of Etsy’s common stock. The net proceeds
from the sale of the Notes were $335.0 million after deducting initial purchasers’ discount and offering expenses. As of
December 31, 2018, we had not received any conversion notices, and, as such, the Notes are not currently redeemable for cash
and are therefore classified as long-term debt. For more information on the Notes, see “Note 13—Debt” in the Notes to
Consolidated Financial Statements.
We believe that our existing cash and cash equivalents and short-term investments, together with cash generated from
operations, will be sufficient to meet our anticipated cash needs for at least the next 12 months. Our future capital requirements
and the adequacy of available funds will depend on many factors, including those described in “Key Factors Affecting Our
Performance” above and in our “Risk Factors” in this Annual Report on Form 10-K.
Subsequent Event
On February 25, 2019, we entered into a $200.0 million senior secured revolving credit facility pursuant to a Credit Agreement
with several lenders (the “2019 Credit Agreement”). The 2019 Credit Agreement will mature in February 2024. The 2019
Credit Agreement includes a letter of credit sublimit of $30.0 million and a swingline loan sublimit of $10.0 million. See “Note
13—Debt—Subsequent Event” in the Notes to Consolidated Financial Statements for additional information.
80
Historical Cash Flows
Cash provided by (used in):
Operating activities
Investing activities
Financing activities
Year Ended December 31,
2018
2017
2016
(in thousands)
$
198,925
$
69,101
$
(285,393)
144,006
61,836
6,555
47,964
(135,430)
(524)
See “Note 1—Basis of Presentation and Summary of Significant Accounting Policies—Revisions” in the Notes to Consolidated
Financial Statements for information on revisions to our Consolidated Statements of Cash Flows for the years ended December
31, 2017 and 2016.
Net Cash Provided by Operating Activities
Our cash flows from operations are largely dependent on the amount of revenue generated on our platform, as well as
associated cost of revenue and other operating expenses. Our primary source of cash from operating activities is cash
collections from our customers. Net cash provided by operating activities in each period presented has been influenced by
changes in accounts receivable, prepaid expenses and other current assets, accounts payable, and accrued liabilities.
Net cash provided by operating activities was $198.9 million in the year ended December 31, 2018, primarily driven by cash
net income of $139.6 million as a result of increased revenue generated on our platform, and changes in our operating assets
and liabilities that provided $59.3 million in cash, largely driven by timing of collections of accounts receivable due to the
launch of our redesigned payment account in the fourth quarter of 2018, which now automatically deducts our fees and
applicable taxes from the seller’s funds earned through sales using Etsy Payments prior to settlement of those funds to the
seller’s bank account and payment timing of payables.
Net cash provided by operating activities was $69.1 million in the year ended December 31, 2017, primarily driven by cash net
income of $68.8 million as a result of increased revenue generated on our platform and changes in our operating assets and
liabilities that provided $0.3 million in cash.
Net cash provided by operating activities was $48.0 million in the year ended December 31, 2016, as a result of the cash net
income of $58.4 million as a result of increased revenue generated on our platform, partially offset by changes in our operating
assets and liabilities that used $10.5 million in cash.
Net Cash (Used in) Provided by Investing Activities
Our primary investing activities consist of sales, maturities, and purchases of short-term marketable securities, cash paid to
purchase intangible assets, and capital expenditures, including investments in capitalized website development and internal-use
software and purchases of property and equipment to support our overall business growth.
Net cash used in investing activities was $285.4 million in the year ended December 31, 2018. This was primarily attributable
to net purchases of marketable securities of $229.3 million, $35.3 million in cash paid for the DaWanda intangible asset
acquisition, and $20.6 million in capital expenditures, including $19.5 million for website development and internal-use
software as we continued to invest in projects adding new features and functionality to the Etsy platform and focused on
growth investments, such as our migration to Google Cloud.
Net cash provided by investing activities was $61.8 million in the year ended December 31, 2017. This was primarily
attributable to net sales of marketable securities of $75.0 million, offset by $13.2 million in capital expenditures, including $9.2
million for capitalized website development and internal-use software and $4.0 million for purchases of property and
equipment.
Net cash used in investing activities was $135.4 million in the year ended December 31, 2016. This was primarily attributable
to net purchases of marketable securities of $79.8 million, capital expenditures of $47.7 million, including $36.0 million for
purchases of property and equipment, $11.7 million for capitalized website development and internal-use software, and $7.9
million in cash paid to acquire Blackbird.
81
Net Cash Provided by (Used in) Financing Activities
Our primary financing activities include proceeds from the issuance of the Notes, repurchase of common stock under share
repurchase programs, payments related to capped call transactions (“Capped Call Transactions”) with the initial purchasers and/
or their respective affiliates in connection with the Notes, shares withheld to satisfy tax withholding obligations in connection
with the vesting of employee RSUs, proceeds from exercise of stock options, payments on our facility financing obligation
related to the build-to-suit accounting treatment of our Brooklyn headquarters lease, and financing of capital leases for
computer and hosting equipment.
Net cash provided by financing activities was $144.0 million in the year ended December 31, 2018. This was primarily
attributable to proceeds from the issuance of the Notes of $345.0 million and proceeds from the exercise of stock options of
$18.3 million, partially offset by stock repurchases under share repurchase programs of $134.6 million, payments of $34.2
million for the Capped Call Transactions, stock repurchases of vested RSUs withheld to satisfy tax obligations of $24.1 million,
payments on our facility financing obligation of $10.2 million, related to our Brooklyn headquarters lease, and $10.0 million of
debt issuance cost payments.
Net cash provided by financing activities was $6.6 million in the year ended December 31, 2017. This was primarily
attributable to proceeds from the exercise of stock options of $33.8 million and proceeds from other financing activities of $3.1
million, partially offset by repurchase of stock under the share repurchase program of $10.3 million, payments on capital lease
obligations of $7.8 million, stock repurchases of vested RSUs withheld to satisfy tax obligations of $6.4 million, and payments
on our facility financing obligation of $5.9 million, related to our Brooklyn headquarters lease.
Net cash used in financing activities was $0.5 million in the year ended December 31, 2016. This was primarily attributable to
payments on capital lease obligations of $6.1 million, outflows from other financing activities of $3.1 million, stock
repurchases of vested RSUs withheld to satisfy tax obligations of $1.3 million and a deferred payment related to the acquisition
of ALM of $0.6 million, offset by proceeds from the exercise of stock options of $10.6 million.
Off-Balance Sheet Arrangements
We did not have any off-balance sheet arrangements, as defined in Item 303(a)(4)(ii) of Regulation S-K, in 2018, 2017, or
2016.
Contractual Obligations
The following table summarizes our future fixed contractual obligations as of December 31, 2018:
Total
Less than 1
Year
1–3
Years
3–5
Years
More than
5 Years
Capital lease obligations
Operating lease obligations
Long-term obligations
Interest payments
Facility financing obligations
Purchase obligations
$
5,979
$
3,884
$
2,095
$
— $
(in thousands)
32,017
345,223
648
78,161
61,070
4,904
132
504
9,451
10,696
8,968
91
144
19,876
33,374
8,385
345,000
—
21,119
17,000
Total contractual obligations
$
523,098
$
29,571
$
64,548
$
391,504
$
—
9,760
—
—
27,715
—
37,475
Capital lease obligations consist of obligations under capital leases for computer and hosting equipment.
Operating lease obligations consist of obligations under non-cancelable operating leases for our headquarters in Brooklyn, New
York and for our offices in San Francisco, Hudson (New York), London, Dublin, Toronto, and New Delhi.
Long-term obligations consist of the issuance of Convertible Senior Notes in 2018, which will mature on March 1, 2023, unless
earlier converted or repurchased and commitments we assumed in connection with our 2014 acquisition of ALM.
Interest payments consist of interest due in connection with our capital leases.
82
Facility financing obligations consist of the portion of our obligations for our headquarters in Brooklyn, New York that is
accounted for as a build-to-suit lease.
Purchase obligations consist of commitments related to the migration of our data centers to the cloud, the related ongoing
service fees, and other support services. For those agreements with variable terms, we do not estimate what the total obligation
may be beyond any minimum quantities and/or pricing.
In addition, we have uncertain tax positions of $18.8 million and non-income tax related contingency reserves of $0.9 million,
which are not reflected in the table as the ultimate resolution and timing are uncertain.
Critical Accounting Policies and Significant Judgments and Estimates
Our management’s discussion and analysis of our financial condition and results of operations is based on our Consolidated
Financial Statements, which have been prepared in accordance with GAAP. The preparation of these Consolidated Financial
Statements requires us to make estimates and assumptions that affect the reported amounts of assets, liabilities, equity, revenue,
expenses, and related disclosures. We evaluate our estimates and assumptions on an ongoing basis. Our estimates are based on
historical experience and various other assumptions that we believe to be reasonable under the circumstances. Our actual
results could differ from these estimates.
We believe that the assumptions and estimates associated with revenue recognition, determining the nature and timing of
satisfaction of performance obligations and stand-alone selling price for use in allocating the subscription price; stock-based
compensation, income taxes, including the assessment of valuation allowances and the accounting for uncertain tax positions;
website development costs and internal-use software, purchase price allocations for business combinations, valuation of
goodwill and intangible assets, leases, restructuring and other exit costs (income), and fair value of financial instruments have
the greatest potential impact on our Consolidated Financial Statements. Therefore, we consider these to be our critical
accounting policies and estimates. For further information on all of our significant accounting policies, see “Note 1—Basis of
Presentation and Summary of Significant Accounting Policies” in the Notes to Consolidated Financial Statements.
Revenue Recognition
Our revenue is diversified; generated from a mix of marketplace activities and other optional services to help Etsy sellers to
generate more sales and scale their businesses. We recognize revenue as we transfer control of promised goods or services to
Etsy sellers, in an amount that reflects the consideration we expect to be entitled to in exchange for those goods or services. We
evaluate whether it is appropriate to recognize revenue on a gross or net basis based upon our evaluation of whether we obtain
control of the specified goods or services by considering if we are primarily responsible for fulfillment of the promise, have
inventory risk, and have latitude in establishing pricing and selecting suppliers, among other factors. Based on our evaluation of
these factors, revenue is recorded either gross or net of costs associated with the transaction. With the exception of Etsy
Shipping Labels, our revenues are recognized on a gross basis. Sales and usage-based taxes are excluded from revenues.
Marketplace revenue: As members of the Etsy marketplace, Etsy sellers receive the benefit of marketplace activities, including
listing items for sale, completing sales transactions, and payments processing, which represents a single stand-ready
performance obligation. Etsy sellers pay a fixed listing fee of $0.20 for each item listed on Etsy.com for a period of four months
or, if earlier, until a sale occurs. Variable fees include the 5% transaction fee that an Etsy seller pays for each completed
transaction, inclusive of shipping fees charged and Etsy Payments fees for processing payments, including foreign currency
payments. On July 16, 2018, we increased our seller transaction fee from 3.5% to 5%, and now apply it to the cost of shipping
in addition to the cost of the item. Etsy Payments processing fees vary between 3% to 4.5% of an item’s total sale price,
including shipping, plus a flat fee per order, depending on the country in which a seller’s bank account is located. When a
foreign currency payment is processed, an additional 2.5% to 5% transaction fee is applied.
The listing fee is recognized ratably over a four-month listing period, unless the item is sold or the seller re-lists it, at which
time any remaining listing fee is recognized. The transaction fee and Etsy Payments fees are recognized when the
corresponding transaction is consummated. Listing fees are nonrefundable while transaction fees and Etsy Payments fees are
recorded net of refunds.
83
Services revenue: Services revenue is derived from optional services we offer to Etsy sellers, which include Promoted Listings,
Etsy Shipping Labels, Pattern, and Etsy Plus. Each service below represents an individual obligation that we must perform
when an Etsy seller chooses to use the service.
• Revenue from Promoted Listings, our on-site advertising service, consists of cost-per-click fees an Etsy seller pays us for
prominent placement of the seller’s listings in search results in our marketplace. Promoted Listings fees are based on an
auction system, which utilizes the budget that each Etsy seller sets when using Promoted Listings to determine the cost-
per-click fee. Promoted Listing fees are nonrefundable and are charged to a seller’s Etsy bill when the Promoted Listing is
clicked; at which time revenue is recognized.
• Revenue from Etsy Shipping Labels consists of fees an Etsy seller pays us when she purchases shipping labels through our
platform, net of the cost we incur in purchasing those shipping labels. We provide our sellers access to purchase shipping
labels from the United States Postal Service, FedEx, Canada Post, Royal Mail and DAI Post at discounted pricing due to
the volume of purchases through its platform. We recognize Etsy Shipping Label revenue when an Etsy seller purchases a
shipping label. We recognize Etsy Shipping Label revenue on a net basis as we are an agent in this arrangement and do not
take control of shipping labels prior to transferring the labels to the Etsy Seller. Etsy Shipping Label revenue is recorded
net of refunds.
• Revenue from Pattern consists of monthly subscription fees an Etsy seller pays to use our custom website services. We
recognize revenue from Pattern ratably over the term of the subscription. The Pattern subscription fee is $15 per month
and is nonrefundable.
• Revenue from Etsy Plus consists of monthly subscription fees an Etsy seller pays for enhanced tools and credits for use on
our platform. The Etsy Plus subscription fee is $10 per month and is nonrefundable. Each feature represents its own
distinct performance obligation. We allocate subscription revenue based on the relative actual or estimated stand-alone
selling price of the features included in the Etsy Plus offering. Enhanced tools include advanced shop customization
options, targeted restock notifications, discounts on branded packaging and promotional materials, and free or discounted
custom web addresses, all of which are recognized ratably over the 30-day subscription period. Additionally, the
subscription includes $5 of Promoted Listing credits and 15 free listing credits per month. The allocated value of
Promoted Listing credits is recognized when the Promoted Listing is clicked, or when the 30-day subscription period
expires. The allocated value of listing credits is deferred until the option is used, and once used, allocated over the four-
month listing period. Any unused listing credits are recognized when the 30-day subscription period expires.
Other revenue: Other revenue typically includes revenue generated from commercial partnerships, which are recognized as the
customer in each contract consumes the benefit of the service we provide in each arrangement.
Stock-Based Compensation
We account for our stock-based compensation awards in accordance with Accounting Standards Codification (“ASC”)
Topic 718—Compensation—Stock Compensation (“ASC 718”). Stock options and RSUs are awarded to employees and
members of our Board of Directors and are measured at fair value at each grant date. For both options and RSUs, vesting is
typically over a four-year period and is contingent upon continued employment on each vesting date. In general, options
granted to newly-hired employees prior to July 2018 vest 25% after the first year of service and ratably each month over the
remaining 36-month period. In general, RSUs granted to newly-hired employees prior to July 2018 vest 25% after the first year
following the vesting commencement date, which is the first day of the fiscal quarter closest to the date of grant, and then vest
ratably each quarter over the remaining 12-quarter period. In general, for current employees who received an additional grant
prior to March 2018, options vest ratably each month over a 48-month period. In general, for current employees who received
an additional grant prior to March 2018, RSUs vest ratably each quarter over a 16-quarter period following the vesting
commencement date, which is the first day of the fiscal quarter closest to the date of grant.
Beginning in July 2018, in general, for newly-hired employees, both options and RSUs vest 25% after the first year of service
and ratably each six-month period over a four-year period following the vesting commencement date, which is the first day of
the month closest to the date of grant. Beginning in March 2018, in general, for current employees who receive an additional
grant, both options and RSUs vest ratably each six-month period over a four-year period following the vesting commencement
date.
Stock-based compensation cost is measured on the grant date, based on the estimated fair value of the award using a Black-
Scholes pricing model and recognized as an expense over the employee’s or director’s requisite service period on a straight-line
basis. The fair value of RSUs is determined based on the closing price of our common stock on Nasdaq on the grant date. In the
first quarter of 2017, we made an accounting policy election to recognize forfeitures as they occur upon adoption of guidance in
ASU 2016-09—Compensation—Stock Compensation: Scope of Modification Accounting. In reporting periods prior to 2017, we
84
estimated forfeitures at the time of grant and revised in subsequent periods as necessary if actual forfeitures differed from
estimates. We expect to continue to grant stock options and RSUs in the future, and, to the extent that we do, our stock-based
compensation expense recognized in future periods will likely increase.
Key Assumptions
Our Black-Scholes option-pricing model requires the input of subjective assumptions, including the fair value of the underlying
common stock, the expected volatility of the price of our common stock, risk-free interest rates, the expected term of the
option, and the expected dividend yield of our common stock. These estimates involve inherent uncertainties and the
application of management’s judgment. If factors change and different assumptions are used, our stock-based compensation
expense could be materially different in the future.
• Fair Value of Our Common Stock: Prior to our initial public offering in April 2015, our Board of Directors considered
numerous objective and subjective factors to determine the fair value of our common stock at each meeting at which
awards were approved. The factors included: contemporaneous third-party valuations of our common stock; the prices,
rights, preferences, and privileges of our preferred stock relative to those of our common stock; the prices of preferred
stock sold by us to third-party investors in arms-length transactions; the prices of common stock sold to third-party
investors by us and in secondary transactions or repurchased by us in arms-length transactions; the lack of marketability of
our common stock; our operating and financial results; current business conditions and projections; and the likelihood of
achieving a liquidity event, such as an initial public offering or sale of our company, given then prevailing market
conditions. Since our initial public offering, we have used the market closing price for our common stock as reported on
the Nasdaq to determine the fair value of our common stock.
• Expected Volatility: As we do not have a sufficient trading history for our common stock, the expected stock price
volatility for our common stock is estimated by taking the average historical price volatility for Etsy and certain industry
peers based on daily price observations over a period equivalent to the expected term of the stock option grants. Industry
peers, which we have selected, consist of several public companies in the industry similar in size, stage of life cycle, and
financial leverage. We intend to continue to consistently apply this process using the same or similar public companies
until a sufficient amount of historical information regarding the volatility of our own common stock share price becomes
available, or unless circumstances change such that the identified companies are no longer similar to us, in which case
more suitable companies whose share prices are publicly available would be used in the calculation.
• Risk-free Interest Rate: The risk-free interest rate is based on the yields of U.S. Treasury securities with maturities similar
to the expected term of the options for each option group.
• Expected Term: The expected term represents the period that our stock-based awards are expected to be outstanding. We
base our expected term for awards issued to employees or members of our Board of Directors on the simplified method,
which represents the average period from vesting to the expiration of the stock option.
• Expected Dividend Yield: We have never declared or paid any cash dividends to common stockholders and do not
presently plan to pay cash dividends in the foreseeable future. Consequently, we use an expected dividend yield of zero.
In determining the fair value of stock options granted, the following weighted-average assumptions were used in the Black-
Scholes option-pricing model for awards granted in the periods indicated:
Expected volatility
Risk-free interest rate
Expected term (in years)
Dividend rate
Income Taxes
Year Ended
December 31,
2018
2017
2016
38.6% - 47.8%
41.7% - 44.2%
38.6% - 44.6%
2.6% - 2.9%
1.9% - 2.2%
1.1% - 2.1%
5.5 - 6.3
—%
5.5 - 6.3
—%
5.5 - 6.3
—%
We account for the income tax (provision) benefit based on income (loss) before income taxes using the asset and liability
method. Under this method, deferred tax assets and liabilities are recognized for the future tax consequences attributable to
differences between the financial statement and tax bases of assets and liabilities using enacted tax rates in effect for the year in
which the differences are expected to settle. The effect on deferred tax assets and liabilities of a change in tax rates is
recognized as income or expense in the period that includes the enactment date. We assess the need for a valuation allowance
on a quarterly basis to reduce deferred tax assets to the amounts we expect to be realized.
85
On December 22, 2017 the TCJA was signed into law. The TCJA requires us to make an accounting policy election of either (1)
treating taxes due on future U.S. inclusions in taxable income related to Global Intangible Low Taxed Income ("GILTI") as a
current period expense when incurred (the “period cost method”) or (2) factoring such amounts into our measurement of our
deferred taxes (the “deferred method”). We recorded tax expense related to GILTI in our effective tax rate for 2018, and have
elected to treat taxes due on future U.S. inclusions in taxable income related to GILTI using the period cost method.
We account for uncertainty in income taxes using a recognition threshold and a measurement attribute for the financial
statement recognition and measurement of tax positions taken or expected to be taken in a tax return. For benefits to be
recognized, a tax position must be more likely than not to be sustained upon examination by the taxing authorities. The amount
recognized is measured as the largest amount of benefit that has a greater than 50% likelihood of being realized upon ultimate
audit settlement.
We recognize interest and penalties, if any, associated with tax matters as part of the income tax provision and include accrued
interest and penalties with the related tax liability in our Consolidated Balance Sheet.
Website Development and Internal-use Software Costs
Costs incurred to develop our website and software for internal-use are capitalized and amortized over the estimated useful life
of the software, generally three to five years. In accordance with authoritative accounting guidance, we begin to capitalize our
costs to develop software when preliminary development efforts are successfully completed, management has authorized and
committed project funding, and it is probable that the project will be completed and the software will be used as intended. We
also capitalize costs related to upgrades and enhancements when it is probable the expenditures will result in additional
functionality or will extend the useful life of existing functionality. Costs related to the design or maintenance of website
development and internal-use software are expensed as incurred. We periodically review these capitalized website development
and internal-use software costs to determine whether the projects will be completed, placed in service, removed from service,
or replaced by other internally-developed or third-party software. If an asset is not expected to provide any future use, the asset
is retired and any unamortized cost is expensed.
If an asset will continue to be used, but the net book value is not expected to be fully recoverable, the asset is impaired to its
fair value. When events or changes in circumstances require, we assess the likelihood of recovering the cost of website
development and internal-use software costs based on its expectations of future profitability, undiscounted cash flows, and our
plans with respect to operations to determine if the asset is impaired and subject to write-off. Measurement of any impairment
loss is based on the excess of the carrying value of the asset over the fair value.
Asset Acquisitions
We have completed asset acquisitions and may complete additional asset acquisitions in the future. In an asset acquisition, we
initially determine whether we acquired a single or group of assets. Acquired assets are recognized based on the purchase price,
which is presumed to equal the fair value of the net assets acquired and amortized in the period over which the asset is expected
to contribute directly or indirectly to the future cash flows of that entity. When circumstances indicate that the carrying value of
these assets may not be recoverable, we review our identifiable amortizable intangible assets for impairment. We accrue for
contingent consideration when payout becomes probable and is reasonably estimable.
Business Combinations, Intangible Assets and Goodwill
We have completed a number of acquisitions of other businesses in the past and may acquire additional businesses or
technologies in the future. In an acquisition, we first review if substantially all of the fair value of the assets acquired is
concentrated in a single identifiable asset or group of similar identifiable assets, in which case the set is not considered a
business and is accounted for as an asset acquisition.
The results of businesses acquired in a business combination are included in our Consolidated Financial Statements from the
date of acquisition. We allocate the purchase price, which is the sum of the consideration provided and may consist of cash,
equity, or a combination of the two, in a business combination to the identifiable assets and liabilities of the acquired business
at their acquisition date fair values. The excess of the purchase price over the amount allocated to the identifiable assets and
liabilities, if any, is recorded as goodwill. Determining the fair value of assets acquired and liabilities assumed requires
management to use significant judgment and estimates, including the selection of valuation methodologies, estimates of future
revenue and cash flows, discount rates, and selection of comparable companies.
When we issue stock-based or cash awards to an acquired company’s stockholders, we evaluate whether the awards are
contingent consideration or compensation for post-combination services. The evaluation includes, among other things, whether
86
the vesting of the awards is contingent on the continued employment of the acquired company’s stockholder beyond the
acquisition date. If continued employment is required for vesting, the awards are treated as compensation for post-combination
services and recognized as expense over the requisite service period.
We initially recognize intangible assets at fair value, and we amortize them on a straight-line basis over their estimated useful
lives. When circumstances indicate that the carrying value of these assets may not be recoverable, we review our identifiable
amortizable intangible assets for impairment.
Goodwill represents the excess of the aggregate fair value of the consideration transferred in a business combination over the
fair value of the assets acquired, net of liabilities assumed. Goodwill is not amortized, but is subject to an annual impairment
test. We have determined that we have a single reporting unit and we perform our annual goodwill impairment test during the
fourth quarter or more frequently if events or changes in circumstances indicate that the goodwill may be impaired.
We have the option to first assess qualitative factors to determine whether the existence of events or circumstances leads to a
determination that it is more likely than not that the fair value of the reporting unit is less than its carrying amount. If, after
assessing the totality of events or circumstances, we determine it is not more likely than not that the fair value of the reporting
unit is less than its carrying amount, then additional impairment testing is not required. However, if we conclude otherwise, we
are then required to perform a quantitative assessment for impairment.
The quantitative assessment involves comparing the estimated fair value of the reporting unit with its respective book value,
including goodwill. If we determine that the estimated fair value exceeds book value, goodwill is considered not to be impaired
and no additional steps are necessary. If, however, we determine that the book value of the reporting unit exceeds the fair value,
we would recognize an impairment loss in an amount equal to the excess, not to exceed the total amount of goodwill allocated
to that reporting unit.
Leases
We lease office space and certain computer equipment in multiple locations under non-cancelable lease agreements. The leases
are reviewed for classification as operating, capital, or build-to-suit leases. For operating leases, rent is recognized on a
straight-line basis over the lease period. For capital leases, we record the leased asset with a corresponding liability. Payments
are recorded as reductions to the liability with an appropriate interest charge recorded based on the then-outstanding remaining
liability. Upon adoption of ASU 2016-02—Leases, we will recognize additional operating liabilities and corresponding right-of-
use assets of the same amount based on the present value of the remaining minimum rental payments under current leasing
standards for existing operating leases.
We consider the nature of the renovations and our involvement during the construction period of newly-leased office space to
determine if we are considered, for accounting purposes only, to be the owner of the construction project during the
construction period. If we determine that we are the owner of the construction project, we are required to capitalize the fair
value of the building as well as the construction costs incurred on our Consolidated Balance Sheet along with a corresponding
financing liability (“build-to-suit accounting”). Upon occupancy for build-to-suit leases, we assess whether the circumstances
qualify for sales recognition under the sale-leaseback accounting guidance. If the lease meets the sale-leaseback criteria, we
will remove the asset and related financial obligation from the balance sheet and treat the building lease as an operating lease.
If upon completion of construction, the project does not meet the sale-leaseback criteria, the leased property will be treated as a
capital lease for financial reporting purposes.
In May 2016, we took possession of our corporate headquarters in Brooklyn, New York upon substantial completion of the
construction phase of the build-out. Upon completion of the project, we performed a sale-leaseback analysis pursuant to
Accounting Standards Codification (“ASC”) 840—Leases, to determine the appropriateness of removing the previously
capitalized assets from the Consolidated Balance Sheets. We concluded that components of “continuing involvement” were
evident as a result of this review, precluding the derecognition of the related assets from the Consolidated Balance Sheets. In
conjunction with the initiation of the lease in May 2014, we also recorded a facility financing obligation equal to the fair
market value of the assets received from the landlord. We do not report rent expense for the lease. Rather, rental payments
under the lease are recognized as a reduction of the financing obligation and interest expense, and the associated asset
capitalized throughout the construction project is depreciated over its estimated useful life. Upon adoption of ASU 2016-02—
Leases, we will derecognize the facility financing obligation and any gains or losses associated with this change in accounting
will be recognized through a cumulative-effect adjustment to accumulated deficit as of January 1, 2019. Additionally, a new
right-of-use asset and lease liability will be recognized on the Consolidated Balance Sheet for the associated lease. See “Note 1
—Basis of Presentation and Summary of Significant Accounting Policies—Recently Issued Accounting Pronouncements” for
additional information on the impact of ASU 2016-02—Leases.
87
Restructuring and Other Exit Costs (Income)
Under certain circumstances, such as the Actions described in “Non-GAAP Financial Measures,” we establish restructuring
accruals for estimated employee severance and other exit costs. These accruals require the use of estimates, and though we
believe the estimates and assumptions are reasonable, they may differ materially from actual costs. We include restructuring
and other exit costs (income) in the applicable operating expense category of the impacted function in the Consolidated
Statements of Operations. See “Note 17—Restructuring and Other Exit Costs (Income)” in the Notes to Consolidated Financial
Statements for additional information.
Fair Value of Financial Instruments
In accounting for the issuance of the Notes discussed in “Liquidity and Capital Resources—Sources of Liquidity,” we used
estimates and assumptions to calculate the carrying amounts of the liability and equity components by measuring the fair value
of similar securities. See “Note 13—Debt” in the Notes to Consolidated Financial Statements for additional information.
Recent Accounting Pronouncements
For information regarding our recently issued accounting pronouncements and recently adopted accounting pronouncements,
please see “Note 1—Basis of Presentation and Summary of Significant Accounting Policies” in the Notes to Consolidated
Financial Statements.
88
Item 7A. Quantitative and Qualitative Disclosures About Market Risk.
We have operations both within the United States and internationally and we are exposed to market risks in the ordinary course
of our business, including the effects of interest rate changes and foreign currency fluctuations. Information relating to
quantitative and qualitative disclosures about these market risks is described below.
Interest Rate Sensitivity
As of December 31, 2018 and December 31, 2017, the majority of our cash and cash equivalents and short-term investments
were held in cash deposits, money market funds, fixed-income funds and U.S. Government and agency securities. The fair
value of our cash, cash equivalents and short-term investments would not be significantly affected by either an increase or
decrease in interest rates due mainly to the short-term nature of these instruments. The majority of our current interest expense
is attributable to our facility financing obligation related to our build-to-suit lease and debt discount related to our Notes and is
not impacted by external factors on interest rates. A 10% increase or decrease in our current interest rate would not have a
significant impact on our interest expense.
Currency Risk
We are a global marketplace. Our revenues are denominated in the currencies of our seller’s ledger currencies, and our
operating expenses are denominated in the currencies of the countries in which our operations are located. In addition, in the
fourth quarter of 2018, we launched a redesigned payment account and began processing seller charges in our seller’s ledger
currencies. Prior to this launch, only Etsy Payments revenues were processed in our seller’s ledger currencies. As a result of
transacting business in multiple foreign currencies, primarily the Euro and Pound Sterling, we are subject to the risk of
fluctuations in foreign currency exchange rates against the U.S. dollar.
In the year ended December 31, 2018, approximately 17% of GMS was from goods that were not listed in U.S. dollars and,
therefore, subject to currency exchange fluctuations. On a currency-neutral basis, GMS growth for the year ended December
31, 2018 would have been 20.4%, or approximately 40 basis points lower than the reported 20.8% growth. On a currency-
neutral basis, GMS growth for the three months ended December 31, 2018 would have been 23.1% compared with the reported
22.3% growth.
In the year ended December 31, 2017, approximately 15% of GMS was from goods that were not listed in U.S. dollars and,
therefore, subject to currency exchange fluctuations. On a currency-neutral basis, GMS growth for the year ended December
31, 2017 would have been 14.3%, or approximately 20 basis points lower than the reported 14.5% growth.
On January 1, 2015, we implemented a revised corporate structure to more closely align our structure with our global
operations and future expansion plans outside of the United States, which resulted in a U.S. dollar-denominated intercompany
debt on a Euro-denominated ledger that was subject to continued currency exchange rate risk through the middle of the fourth
quarter of 2017. In the fourth quarter of 2017, we established a new legal entity based in Ireland with a U.S. dollar functional
currency to help mitigate the currency rate risk on our intercompany debt.
For the purpose of analyzing foreign currency exchange risk, we considered the historical trends in foreign currency exchange
rates and determined that it was reasonably possible that adverse changes in exchange rates of 10% could be experience in the
near term. An adverse 10% foreign currency exchange rate would have resulted in a decrease to revenue of $7.5 million or
approximately 1.2% of total revenue and a currency exchange loss of $17.0 million for the year ended December 31, 2018. This
compares to a revenue decrease of $3.7 million or 0.8% of total revenue and currency exchange loss of $22.5 million based on
the same analysis performed for the year ended December 31, 2017.
89
Item 8. Financial Statements and Supplementary Data.
The supplementary financial information required by this item is included in “Management’s Discussion and Analysis of
Financial Condition and Results of Operations.”
Etsy, Inc.
Index to the Consolidated Financial Statements
Report of Independent Registered Public Accounting Firm
Consolidated Balance Sheets as of December 31, 2018 and 2017
Consolidated Statements of Operations for the years ended December 31, 2018, 2017, and 2016
Consolidated Statements of Comprehensive Income (Loss) for the years ended December 31, 2018,
2017, and 2016
Consolidated Statement of Changes in Stockholders' Equity for the years ended December 31, 2018,
2017, and 2016
Consolidated Statements of Cash Flows for the years ended December 31, 2018, 2017, and 2016
Notes to Consolidated Financial Statements
91
93
94
95
96
97
99
90
Report of Independent Registered Public Accounting Firm
To the Stockholders and Board of Directors of Etsy, Inc.
Opinions on the Financial Statements and Internal Control over Financial Reporting
We have audited the accompanying consolidated balance sheets of Etsy, Inc. and its subsidiaries (the “Company”) as of
December 31, 2018 and 2017, and the related consolidated statements of operations, comprehensive income (loss), changes in
stockholders’ equity and cash flows for each of the three years in the period ended December 31, 2018, including the related
notes (collectively referred to as the “consolidated financial statements”). We also have audited the Company's internal control
over financial reporting as of December 31, 2018, based on criteria established in Internal Control - Integrated Framework
(2013) issued by the Committee of Sponsoring Organizations of the Treadway Commission (COSO).
In our opinion, the consolidated financial statements referred to above present fairly, in all material respects, the financial
position of the Company as of December 31, 2018 and 2017, and the results of its operations and its cash flows for each of the
three years in the period ended December 31, 2018 in conformity with accounting principles generally accepted in the United
States of America. Also in our opinion, the Company maintained, in all material respects, effective internal control over
financial reporting as of December 31, 2018, based on criteria established in Internal Control - Integrated Framework (2013)
issued by the COSO.
Basis for Opinions
The Company's management is responsible for these consolidated financial statements, for maintaining effective internal
control over financial reporting, and for its assessment of the effectiveness of internal control over financial reporting, included
in Management’s Report on Internal Control Over Financial Reporting appearing under Item 9A. Our responsibility is to
express opinions on the Company’s consolidated financial statements and on the Company's internal control over financial
reporting based on our audits. We are a public accounting firm registered with the Public Company Accounting Oversight
Board (United States) (PCAOB) and are required to be independent with respect to the Company in accordance with the U.S.
federal securities laws and the applicable rules and regulations of the Securities and Exchange Commission and the PCAOB.
We conducted our audits in accordance with the standards of the PCAOB. Those standards require that we plan and perform the
audits to obtain reasonable assurance about whether the consolidated financial statements are free of material misstatement,
whether due to error or fraud, and whether effective internal control over financial reporting was maintained in all material
respects.
Our audits of the consolidated financial statements included performing procedures to assess the risks of material misstatement
of the consolidated financial statements, whether due to error or fraud, and performing procedures that respond to those risks.
Such procedures included examining, on a test basis, evidence regarding the amounts and disclosures in the consolidated
financial statements. Our audits also included evaluating the accounting principles used and significant estimates made by
management, as well as evaluating the overall presentation of the consolidated financial statements. Our audit of internal
control over financial reporting included obtaining an understanding of internal control over financial reporting, assessing the
risk that a material weakness exists, and testing and evaluating the design and operating effectiveness of internal control based
on the assessed risk. Our audits also included performing such other procedures as we considered necessary in the
circumstances. We believe that our audits provide a reasonable basis for our opinions.
Definition and Limitations of Internal Control over Financial Reporting
A company’s internal control over financial reporting is a process designed to provide reasonable assurance regarding the
reliability of financial reporting and the preparation of financial statements for external purposes in accordance with generally
accepted accounting principles. A company’s internal control over financial reporting includes those policies and procedures
that (i) pertain to the maintenance of records that, in reasonable detail, accurately and fairly reflect the transactions and
91
dispositions of the assets of the company; (ii) provide reasonable assurance that transactions are recorded as necessary to
permit preparation of financial statements in accordance with generally accepted accounting principles, and that receipts and
expenditures of the company are being made only in accordance with authorizations of management and directors of the
company; and (iii) provide reasonable assurance regarding prevention or timely detection of unauthorized acquisition, use, or
disposition of the company’s assets that could have a material effect on the financial statements.
Because of its inherent limitations, internal control over financial reporting may not prevent or detect misstatements. Also,
projections of any evaluation of effectiveness to future periods are subject to the risk that controls may become inadequate
because of changes in conditions, or that the degree of compliance with the policies or procedures may deteriorate.
/s/ PricewaterhouseCoopers LLP
New York, New York
February 28, 2019
We have served as the Company’s auditor since 2012.
92
Etsy, Inc.
Consolidated Balance Sheets
(In thousands except share and per share amounts)
ASSETS
Current assets:
Cash and cash equivalents
Short-term investments
Accounts receivable, net
Prepaid and other current assets
Funds receivable and seller accounts
Total current assets
Restricted cash
Property and equipment, net
Goodwill
Intangible assets, net
Deferred tax assets
Other assets
Total assets
LIABILITIES AND STOCKHOLDERS’ EQUITY
Current liabilities:
Accounts payable
Accrued expenses
Capital lease obligations—current
Funds payable and amounts due to sellers
Deferred revenue
Other current liabilities
Total current liabilities
Capital lease obligations—net of current portion
Deferred tax liabilities
Facility financing obligation
Long-term debt, net
Other liabilities
Total liabilities
Commitments and contingencies (Note 14)
Stockholders’ equity:
Common stock ($0.001 par value, 1,400,000,000 shares authorized as of December 31,
2018 and 2017; 119,771,702 and 121,769,238 shares issued and outstanding as of
December 31, 2018 and 2017, respectively)
Preferred stock ($0.001 par value, 25,000,000 shares authorized as of December 31, 2018
and 2017)
Additional paid-in capital
Accumulated deficit
Accumulated other comprehensive loss
Total stockholders’ equity
Total liabilities and stockholders’ equity
$
$
As of December 31,
2018
2017
$
366,985
$
315,442
257,302
12,244
22,686
21,072
680,289
5,341
120,179
37,482
34,589
23,464
507
25,108
33,677
20,379
44,658
439,264
5,341
117,617
38,541
4,100
159
561
901,851
$
605,583
26,545
$
49,158
3,884
21,072
7,478
3,925
112,062
2,095
30,455
59,991
276,486
19,864
500,953
120
—
562,033
(153,442)
(7,813)
400,898
$
901,851
$
13,622
28,743
5,798
44,658
6,262
3,394
102,477
4,115
23,786
60,049
—
18,262
208,689
122
—
499,441
(96,290)
(6,379)
396,894
605,583
The accompanying notes are an integral part of these Consolidated Financial Statements
93
Etsy, Inc.
Consolidated Statements of Operations
(In thousands except share and per share amounts)
Revenue
Cost of revenue
Gross profit
Operating expenses:
Marketing
Product development
General and administrative
Asset impairment charges
Total operating expenses
Income from operations
Other (expense) income:
Interest expense
Interest and other income
Foreign exchange (loss) gain
Total other (expense) income
Income (loss) before income taxes
Benefit (provision) for income taxes
Net income (loss)
Net income (loss) per share attributable to common stockholders:
Basic
Diluted
Weighted average common shares outstanding:
Basic
Diluted
Year Ended
December 31,
2018
2017
2016
$
603,693
$
441,231
$
190,762
412,931
158,013
97,249
82,883
—
338,145
74,786
(22,178)
8,957
(6,487)
(19,708)
55,078
22,413
150,986
290,245
109,085
74,616
91,486
3,162
278,349
11,896
(11,130)
2,394
29,105
20,369
32,265
49,535
77,491
$
81,800
$
364,967
123,328
241,639
82,248
55,083
86,180
551
224,062
17,577
(7,204)
1,702
(14,951)
(20,453)
(2,876)
(27,025)
(29,901)
$
$
$
0.64
0.61
$
$
0.69
0.68
$
$
(0.26)
(0.26)
120,146,076
118,538,687
113,562,738
127,084,785
122,267,673
113,562,738
The accompanying notes are an integral part of these Consolidated Financial Statements
94
Etsy, Inc.
Consolidated Statements of Comprehensive Income (Loss)
(In thousands)
Net income (loss)
Other comprehensive (loss) income:
Cumulative translation adjustment
Unrealized (losses) gains on marketable securities, net of tax of $0, $15, and $5,
respectively
Total other comprehensive (loss) income
Comprehensive income (loss)
Year Ended
December 31,
2018
2017
2016
$
77,491
$
81,800
$
(29,901)
(1,399)
(24,898)
(35)
(1,434)
47
(24,851)
7,675
(8)
7,667
$
76,057
$
56,949
$
(22,234)
The accompanying notes are an integral part of these Consolidated Financial Statements
95
Etsy, Inc.
Consolidated Statements of Changes in Stockholders’ Equity
(In thousands except share amounts)
Balance as of December 31, 2015
Stock-based compensation
Exercise of vested options
Vesting of restricted stock units, net of shares withheld
Exercise of warrants, net of shares withheld
Retirement of restricted shares
Issuance of common stock at acquisition date
Stock-based compensation—acquisitions
Conversion of liability-classified restricted shares upon vesting
Excess tax benefit from the exercise of options
Other comprehensive income
Net loss
Balance as of December 31, 2016
Stock-based compensation
Exercise of vested options
Vesting of restricted stock units, net of shares withheld
Stock repurchase
Stock-based compensation—acquisitions
Conversion of liability-classified restricted shares upon vesting
Cumulative effect adjustment
Other comprehensive loss
Net income
Balance as of December 31, 2017
Stock-based compensation
Exercise of vested options
Issuance of convertible senior notes, net of issuance costs and taxes
Purchase of capped call, net of taxes
Vesting of restricted stock units, net of shares withheld
Stock repurchase
Stock-based compensation—acquisitions
Other comprehensive loss
Net income
Balance as of December 31, 2018
Common Stock
Shares
Amount
Additional
Paid-in
Capital
Accumulated
Deficit
Accumulated
Other
Comprehensive
Income (Loss)
Total
112,563,354
$
113
$
406,020
$
(86,440)
$
10,805
$
330,498
—
2,535,620
144,651
80,011
(36,346)
685,749
—
—
—
—
—
115,973,039
—
5,760,263
622,167
(586,231)
—
—
—
—
—
—
3
—
—
—
—
—
—
—
—
—
116
—
6
1
(1)
—
—
—
—
—
13,960
10,565
(1,258)
—
—
6,966
1,080
1,942
3,235
—
—
442,510
23,462
33,832
(6,418)
—
3,132
2,838
85
—
—
121,769,238
122
499,441
—
1,588,779
—
—
860,102
(4,446,417)
—
—
—
—
1
—
—
1
(4)
—
—
—
36,729
18,252
53,323
(25,400)
(24,066)
—
3,754
—
—
—
—
—
—
—
—
—
—
—
—
(29,901)
(116,341)
—
—
—
(10,300)
—
—
(51,449)
—
81,800
(96,290)
—
—
—
—
(134,643)
—
—
77,491
—
—
—
—
—
—
—
—
—
7,667
—
18,472
—
—
—
—
—
—
—
(24,851)
—
(6,379)
—
—
—
—
—
—
(1,434)
—
119,771,702
$
120
$
562,033
$
(153,442)
$
(7,813)
$
13,960
10,568
(1,258)
—
—
6,966
1,080
1,942
3,235
7,667
(29,901)
344,757
23,462
33,838
(6,417)
(10,301)
3,132
2,838
(51,364)
(24,851)
81,800
396,894
36,729
18,253
53,323
(25,400)
(24,065)
(134,647)
3,754
(1,434)
77,491
400,898
The accompanying notes are an integral part of these Consolidated Financial Statements
96
Etsy, Inc.
Consolidated Statements of Cash Flows
(In thousands)
Cash flows from operating activities
Net income (loss)
Adjustments to reconcile net income (loss) to net cash provided by operating activities:
Year Ended
December 31,
2018
2017
2016
$
77,491
$
81,800
$
(29,901)
Stock-based compensation expense
Stock-based compensation expense—acquisitions
Depreciation and amortization expense
Bad debt expense
Foreign exchange loss (gain)
Amortization of debt issuance costs
Non-cash interest expense
Interest on marketable securities
Loss on disposal of assets
Asset impairment charges
Deferred income taxes
Amortization of deferred tax charge
Changes in operating assets and liabilities, net of acquisitions:
Accounts receivable
Funds receivable and seller accounts
Prepaid expenses and other current assets
Other assets
Accounts payable
Accrued and other current liabilities
Funds payable and amounts due to sellers
Deferred revenue
Other liabilities
Net cash provided by operating activities
Cash flows from investing activities
Cash paid for asset acquisition and intangible assets
Acquisition of businesses, net of cash acquired
Purchases of property and equipment
Development of internal-use software
Purchases of marketable securities
Sales of marketable securities
Net cash (used in) provided by investing activities
Cash flows from financing activities
Payment of tax obligations on vested equity awards
Repurchase of stock
Proceeds from exercise of stock options
Proceeds from issuance of convertible senior notes
Payment of debt issuance costs
Purchase of capped call
Payments on capital lease obligations
Deferred payments on acquisition of business
Payments on facility financing obligation
Other financing, net
Net cash provided by (used in) financing activities
Effect of exchange rate changes on cash
Net increase (decrease) in cash, cash equivalents, and restricted cash
Cash, cash equivalents, and restricted cash at beginning of period
Cash, cash equivalents, and restricted cash at end of period
$
97
34,477
3,754
26,742
4,124
5,997
1,191
10,968
(2,887)
136
—
(22,414)
—
17,215
23,436
(4,785)
43
13,364
23,079
(23,436)
1,331
9,099
198,925
(35,494)
—
(1,019)
(19,537)
(514,286)
284,943
(285,393)
(24,065)
(134,647)
18,253
345,000
(9,962)
(34,224)
(6,057)
—
(10,164)
(128)
144,006
(5,995)
51,543
320,783
372,326
$
22,655
3,904
27,197
2,497
(27,424)
463
3,117
426
520
3,162
(49,535)
—
(8,826)
(13,477)
3,024
(28)
2,837
(2,659)
13,477
434
5,537
69,101
—
—
(3,948)
(9,208)
(62,348)
137,340
61,836
(6,417)
(10,301)
33,838
—
—
—
(7,798)
—
(5,883)
3,116
6,555
(3,642)
133,850
186,933
320,783
$
13,168
2,733
22,525
1,770
12,921
184
5,337
914
1,143
551
9,969
17,132
(8,192)
(10,910)
(1,384)
438
(3,585)
795
10,910
964
482
47,964
—
(7,880)
(35,981)
(11,769)
(160,504)
80,704
(135,430)
(1,258)
—
10,568
—
—
—
(6,086)
(649)
—
(3,099)
(524)
(1,662)
(89,652)
276,585
186,933
Etsy, Inc.
Consolidated Statements of Cash Flows
(In thousands)
Supplemental cash flow disclosures:
Cash paid for interest
Cash paid for income taxes
Supplemental non-cash disclosures:
Equipment acquired under capital lease obligations
Stock-based compensation capitalized in development of capitalized software
Additions to development of internal-use software and property and equipment included
in accounts payable and accrued expenses
Fair value of common stock issued in acquisition
Year Ended
December 31,
2018
2017
2016
$
$
$
$
$
$
10,002
966
2,122
2,252
1,211
$
$
$
$
$
7,555
1,003
5,586
807
956
$
$
$
$
$
— $
— $
2,000
10,559
5,030
792
2,239
6,966
The accompanying notes are an integral part of these Consolidated Financial Statements
98
Etsy, Inc.
Notes to Consolidated Financial Statements
Note 1—Basis of Presentation and Summary of Significant Accounting Policies
Description of Business
Etsy, Inc. (the “Company” or “Etsy”) was incorporated in Delaware in February 2006. Etsy is the global marketplace for unique
and creative goods. The Company generates revenue primarily from transaction and listing fees, Etsy Payments fees, Promoted
Listing fees, Etsy Shipping Label sales, Pattern fees, and Etsy Plus subscription fees.
Basis of Consolidation
The Consolidated Financial Statements include the accounts of Etsy and its wholly-owned subsidiaries. All intercompany
balances and transactions have been eliminated in consolidation.
Reclassifications
Certain items in the prior years’ Consolidated Financial Statements have been reclassified to conform to the current year
presentation reflected in the Consolidated Financial Statements. Specifically, the Company reclassified $0.2 million previously
included in other assets to deferred tax assets on the Consolidated Balance Sheet for the year ended December 31, 2017 to
conform to the current year presentation.
Additionally, the Company reclassified $146.6 million and $111.4 million previously included in Services revenue to
Marketplace revenue (see “Note 2—Revenue”) for the years ended December 31, 2017 and 2016, respectively, to conform to
the current year presentation in connection with the adoption of Accounting Standards Codification (“ASC”) 606—Revenue
from Contracts with Customers.
The Company also reclassified $5.3 million on the Consolidated Statement of Cash Flows in the years ended December 31,
2017 and 2016 to include restricted cash in the beginning and ending cash, cash equivalents, and restricted cash balances to
conform to the current year presentation upon adoption of Accounting Standards Update (“ASU”) 2016-18—Statement of Cash
Flows: Restricted Cash.
The Company also reclassified $1.6 million and $7.8 million previously included in changes in prepaid expenses and other
current assets, accrued and other current liabilities, and other liabilities to deferred income taxes on the Consolidated Statements
of Cash Flows for the years ended December 31, 2017 and 2016, respectively, to conform to the current year presentation.
Revisions
The Company revised the Consolidated Statement of Cash Flows for the years ended December 31, 2017 and 2016 to correct
the presentation of the effect of exchange rate changes on cash. This revision resulted in an increase (decrease) of $1.7 million
in cash flows from operating activities, $3.1 million in cash flows from financing activities, and $(4.8) million in effect of
exchange rate changes on cash in the year ended December 31, 2017 and an increase (decrease) of $(2.0) million in cash flows
from operating activities, $(3.1) million in cash flows from financing activities, and $5.1 million in effect of exchange rate
changes on cash in the year ended December 31, 2016.
Additionally, the 2018 quarterly periods will also be revised in connection with our future 2019 unaudited interim condensed
Consolidated Financial Statement filings in Quarterly Reports on Form 10-Q. The Company will revise the Consolidated
Statements of Cash Flows for the year-to-date periods ended September 30, 2018, June 30, 2018 and March 31, 2018 to correct
the presentation of the effect of exchange rate changes on cash. This revision will result in an increase (decrease) of $(0.3)
million in cash flows from operating activities, $4.0 million in cash flows from financing activities, and $(3.7) million in effect
of exchange rate changes on cash in the nine months ended September 30, 2018, an increase (decrease) of $0.3 million in cash
flows from operating activities, $1.0 million in cash flows from financing activities, and $(1.3) million in effect of exchange
rate changes on cash in the six months ended June 30, 2018, and an increase (decrease) of $(0.3) million in cash flows from
operating activities, $(2.7) million in cash flows from financing activities, and $3.0 million in effect of exchange rate changes
on cash in the three months ended March 31, 2018.
99
Etsy, Inc.
Notes to Consolidated Financial Statements
These revisions do not impact the Consolidated Statements of Operations, the Consolidated Statements of Comprehensive
Income (Loss), or the Consolidated Balance Sheets. The Company has concluded that the effect of this revision is not material
to any of our previously issued financial statements.
Correction of Errors
During the year ended December 31, 2018, the Company recorded adjustments to correct errors in the years ended
December 31, 2018, 2017 and 2016 that increased income before income taxes by $1.5 million in the current year and
decreased net income by $1.3 million in the current year. The Company has concluded that the errors and their correction were
not material to the Consolidated Financial Statements for any of the periods impacted nor are they material for the 2018 results.
Use of Estimates
The preparation of the Company’s Consolidated Financial Statements in conformity with accounting principles generally
accepted in the United States of America (“GAAP”) requires management to make estimates and judgments that affect the
reported amounts of assets and liabilities and disclosure of contingent assets, liabilities and equity at the date of the
Consolidated Financial Statements and the reported amounts of revenues and expenses during the reporting period. The
accounting estimates that require management’s most difficult and subjective judgments include: for revenue recognition,
determining the nature and timing of satisfaction of performance obligations and stand-alone selling price for use in allocating
the subscription price; income taxes, including the assessment of valuation allowances and the accounting for uncertain tax
positions; website development costs and internal-use software; purchase price allocations for business combinations; valuation
of goodwill and intangible assets; leases; stock-based compensation; restructuring and other exit costs (income); and fair value
of financial instruments. The Company evaluates its estimates and judgments on an ongoing basis and revises them when
necessary. Actual results may differ from the original or revised estimates.
Revenue Recognition
The Company’s revenue is diversified; generated from a mix of marketplace activities and other optional services to help Etsy
sellers to generate more sales and scale their businesses. Revenues are recognized as the Company transfers control of promised
goods or services to Etsy sellers, in an amount that reflects the consideration the Company expects to be entitled to in exchange
for those goods or services. The Company evaluates whether it is appropriate to recognize revenue on a gross or net basis based
upon its evaluation of whether the Company obtains control of the specified goods or services by considering if it is primarily
responsible for fulfillment of the promise, has inventory risk, and has the latitude in establishing pricing and selecting suppliers,
among other factors. Based on its evaluation of these factors, revenue is recorded either gross or net of costs associated with the
transaction. With the exception of Etsy Shipping Labels, the Company’s revenues are recognized on a gross basis. Sales and
usage-based taxes are excluded from revenues.
Marketplace revenue: As members of the Etsy marketplace, Etsy sellers receive the benefit of marketplace activities, including
listing items for sale, completing sales transactions, and payments processing, which represents a single stand-ready
performance obligation. Etsy sellers pay a fixed listing fee of $0.20 for each item listed on Etsy.com for a period of four months
or, if earlier, until a sale occurs. Variable fees include the 5% transaction fee that an Etsy seller pays for each completed
transaction, inclusive of shipping fees charged, and Etsy Payments fees for processing payments, including foreign currency
payments. On July 16, 2018, the Company increased the seller transaction fee from 3.5% to 5% of each completed transaction,
and now applies it to the cost of shipping in addition to the cost of the item. Etsy Payments processing fees vary between 3–
4.5% of an item’s total sale price, including shipping, plus a flat fee per order, depending on the country in which a seller’s bank
account is located. When a foreign currency payment is processed, an additional 2.5–5% transaction fee is applied.
The listing fee is recognized ratably over a four-month listing period, unless the item is sold or the seller re-lists it, at which
time any remaining listing fee is recognized. The transaction fee and Etsy Payments fees are recognized when the
corresponding transaction is consummated. Listing fees are nonrefundable while transaction fees and Etsy Payments fees are
recorded net of refunds.
100
Etsy, Inc.
Notes to Consolidated Financial Statements
Services revenue: Services revenue is derived from optional services offered to Etsy sellers, which include Promoted Listings,
Etsy Shipping Labels, Pattern, and Etsy Plus. Each service below represents an individual obligation that the Company must
perform when an Etsy seller chooses to use the service.
• Revenue from Promoted Listings, the Company’s on-site advertising service, consists of cost-per-click fees an Etsy seller
pays for prominent placement of the seller’s listings in search results in the Company’s marketplace. Promoted Listings
fees are based on an auction system, which utilizes the budget that each Etsy seller sets when using Promoted Listings to
determine the cost-per-click fee. Promoted Listing fees are nonrefundable and are charged to a seller’s Etsy bill when the
Promoted Listing is clicked; at which time revenue is recognized.
• Revenue from Etsy Shipping Labels consists of fees an Etsy seller pays the Company when she purchases shipping labels
through its platform, net of the cost the Company incurs in purchasing those shipping labels. The Company provides its
sellers access to purchase shipping labels from the United States Postal Service, FedEx, Canada Post, Royal Mail, and DAI
Post at discounted pricing due to the volume of purchases through its platform. The Company recognizes Etsy Shipping
Label revenue when an Etsy seller purchases a shipping label. The Company recognizes Etsy Shipping Label revenue on a
net basis as it is an agent in this arrangement and does not take control of shipping labels prior to transferring the labels to
the Etsy Seller. Etsy Shipping Label revenue is recorded net of refunds.
• Revenue from Pattern consists of monthly subscription fees an Etsy seller pays to use the Company’s custom website
services. The Company recognizes revenue from Pattern ratably over the term of the subscription. The Pattern subscription
fee is $15 per month and is nonrefundable.
• Revenue from Etsy Plus consists of monthly subscription fees an Etsy seller pays for enhanced tools and credits for use on
the Company’s platform. The Etsy Plus subscription fee is $10 per month and is nonrefundable. Each feature represents its
own distinct performance obligation. The Company allocates subscription revenue based on the relative actual or
estimated stand-alone selling price of the features included in the Etsy Plus offering. Enhanced tools include advanced
shop customization options, targeted restock notifications, discounts on branded packaging and promotional materials, and
free or discounted custom web addresses, all of which are recognized ratably over the 30-day subscription period.
Additionally, the subscription includes $5 of Promoted Listing credits and 15 free listing credits per month. The allocated
value of Promoted Listing credits is recognized when the Promoted Listing is clicked, or when the 30-day subscription
period expires. The allocated value of listing credits is deferred until the option is used, and once used, allocated over the
four-month listing period. Any unused listing credits are recognized when the 30-day subscription period expires.
Other revenue: Other revenue typically includes revenue generated from commercial partnerships, which are recognized as the
customer in each contract consumes the benefit of the service Etsy provides in each arrangement.
Cost of Revenue
Cost of revenue primarily consists of the cost of interchange and other fees for credit card processing services, credit card
verification service fees, and credit card chargebacks to support Etsy Payments revenue, and costs of refunds made to Etsy
buyers that the Company is not able to collect from Etsy sellers. Cost of revenue also includes expenses associated with the
operation and maintenance of the Company’s platform and its data centers, including employee-related costs, hosting and
bandwidth costs, and depreciation and amortization.
Marketing
Marketing expenses largely consist of direct marketing and indirect employee-related expenses to support our marketing
initiatives. Direct marketing includes digital marketing, brand marketing and television, seller lifecycle and growth activities,
public relations, communications, and marketing partnerships. Digital marketing, also referred to as performance marketing,
primarily consists of targeted promotional campaigns through electronic channels, such as product listing ads, search engine
marketing, affiliate programs, and display advertising which are focused on buyer acquisition and brand marketing. Advertising
expenses are recognized as incurred, with the exception of certain production expenses related to television and display
advertising which are deferred until the first time an advertisement airs or is published. If such advertising is not expected to
occur, costs are expensed immediately. Advertising expenses related to direct marketing, included in marketing expenses on the
Consolidated Statements of Operations, were $129.1 million, $78.4 million, and $55.5 million in the years ended December 31,
2018, 2017, and 2016, respectively.
101
Etsy, Inc.
Notes to Consolidated Financial Statements
Product Development
Product development expenses consist primarily of employee-related expenses for engineering, product management, product
design, and product research activities. Additional expenses include consulting costs related to the development, quality
assurance, and testing of new technology and enhancement of our existing technology.
Stock-Based Compensation
The Company accounts for its stock-based compensation awards in accordance with ASC Topic 718—Compensation—Stock
Compensation (“ASC 718”). Stock options and restricted stock units (“RSUs”) are awarded to employees and members of the
Company’s Board of Directors and are measured at fair value at each grant date. The Company calculates the fair value of stock
options on the date of grant using the Black-Scholes option-pricing model and the expense is recognized over the requisite
service period. Prior to the IPO, the Company utilized equity valuations based on comparable publicly-traded companies,
discounted free cash flows, an analysis of the Company’s enterprise value, and other factors deemed relevant in estimating the
fair value of its common stock. Subsequent to the IPO, the Company has used the closing price of its common stock on Nasdaq
as the fair value of its common stock. The risk-free rate for periods within the contractual life of the option is based on the U.S.
Treasury yield curve in effect at the time of grant. Expected volatilities are based on implied volatilities from market
comparisons of Etsy and certain publicly traded companies, and other factors. The expected term of stock options granted has
been determined using the simplified method, which uses the midpoint between the vesting date and the contractual term. The
fair value of RSUs is determined based on the closing price of the Company’s common stock on Nasdaq on the grant date. The
requisite service period for stock options and RSUs is generally four years from the date of grant.
In the first quarter of 2017, the Company made an accounting policy election to recognize forfeitures as they occur upon
adoption of guidance in ASU 2016-09—Compensation—Stock Compensation: Scope of Modification Accounting. In reporting
periods prior to 2017, the Company estimated forfeitures at the time of grant and revised in subsequent periods as necessary if
actual forfeitures differed from estimates.
The Company accounted for stock-based compensation arrangements related to the A Little Market (“ALM”) acquisition in
restricted shares, subject to a put option that allows the holder of the shares to put the shares back to the Company for cash, as
liability-classified stock awards. These awards were re-measured at fair value each reporting period, with changes in fair value
being charged to the Consolidated Statement of Operations. Compensation expense was recognized using a graded vesting
methodology for each separately vesting tranche as though the award were, in substance, multiple awards. Unless the put option
was exercised, the restricted shares were to be reclassified from a liability to an equity classified award upon the termination of
the put option at the vesting of each separate tranche. In 2017, all outstanding restricted shares subject to a put option became
fully vested and the Company is no longer required to remeasure these awards at fair value going forward.
Foreign Currency
The Company has determined that the functional currency for each of its foreign operations is the currency of the primary cash
flow of the operations, which is generally the local currency in which the operation is located. All assets and liabilities are
translated into U.S. dollars using exchange rates in effect at the balance sheet date. Revenue and expenses are translated using
average exchange rates during the period. Foreign currency translation adjustments are reflected in stockholders’ equity as a
component of other comprehensive income (loss). Transaction gains and losses including intercompany balances denominated
in a currency other than the functional currency of the entity involved are included in foreign exchange gain (loss) within other
income (expense) in the Consolidated Statement of Operations.
Income Taxes
The income tax (provision) benefit is based on income (loss) before income taxes and is accounted for under the asset and
liability method. Under this method, deferred tax assets and liabilities are recognized for the future tax consequences
attributable to differences between the financial statement and tax bases of assets and liabilities using enacted tax rates in effect
for the year in which the differences are expected to settle. The effect on deferred tax assets and liabilities of a change in tax
rates is recognized as income or expense in the period that includes the enactment date. Management assesses the need for a
valuation allowance on a quarterly basis to reduce deferred tax assets to the amounts expected to be realized.
102
Etsy, Inc.
Notes to Consolidated Financial Statements
On December 22, 2017 the Tax Cuts and Jobs Act of 2017 (the “TCJA”) was signed into law. The TCJA requires the Company
to make an accounting policy election of either (1) treating taxes due on future U.S. inclusions in taxable income related to
Global Intangible Low Taxed Income ("GILTI") as a current period expense when incurred (the “period cost method”) or (2)
factoring such amounts into the Company’s measurement of its deferred taxes (the “deferred method”). The Company has
recorded tax expense related to GILTI in its effective tax rate for 2018, and has elected to treat taxes due on future U.S.
inclusions in taxable income related to GILTI as a current period expense when incurred using the period cost method.
The Company accounts for uncertainty in income taxes using a recognition threshold and a measurement attribute for the
financial statement recognition and measurement of tax positions taken or expected to be taken in a tax return. For benefits to
be recognized, a tax position must be more likely than not to be sustained upon examination by the taxing authorities. The
amount recognized is measured as the largest amount of benefit that has a greater than 50% likelihood of being realized upon
ultimate audit settlement.
The Company recognizes interest and penalties, if any, associated with income tax matters as part of the income tax provision
and includes accrued interest and penalties with the related income tax liability in the Consolidated Balance Sheet.
Excess Tax Benefits from Exercise of Stock Options
As of the first quarter of 2017, the Company adopted ASU 2016-09—Stock Compensation: Improvements to Employee Share-
based Payment Accounting, for share-based payment transactions that require a reporting entity to recognize excess tax benefits
and deficiencies as income tax expense or benefit in the income statement. Prior to this adoption, including the year ended
December 31, 2016, the Company used the “with and without” approach in determining the order in which tax attributes were
utilized. As a result, the Company recognized a tax benefit from stock-based awards (“windfall”) in additional paid-in capital
only if an incremental tax benefit was realized after all other tax attributes available to the Company had been utilized. When
tax deductions from stock-based awards were less than the cumulative book compensation expense, the tax effect of the
resulting difference (“shortfall”) was charged first to additional paid-in capital, to the extent of the Company’s pool of windfall
tax benefits, with any remainder recognized in income tax expense.
Net Income (Loss) Per Share
Basic net income (loss) per share attributable to common stockholders is computed by dividing the net income (loss)
attributable to common stockholders by the weighted-average number of common shares outstanding for the period. Diluted net
income (loss) per share is computed by dividing net income (loss) for the period by the weighted-average number of shares of
common stock and potentially dilutive common stock outstanding during the period. Net income in the diluted net income per
share calculation is adjusted for income or loss from fair value adjustments on instruments accounted for as liabilities, but
which may be settled in shares. The dilutive effect of outstanding options and stock-based compensation awards is reflected in
diluted net income (loss) per share by application of the treasury stock method. Since the Company expects to settle in cash the
principal outstanding under the 0% Convertible Senior Notes due 2023 the Company issued in March 2018 (the “Notes,” see
“Note 13—Debt”), it uses the treasury stock method when calculating the potential dilutive effect of the conversion spread on
diluted net income per share, if applicable. The conversion spread will have a dilutive impact on diluted net income per share of
common stock when the average market price of the Company’s common stock for a given period exceeds the conversion price
of $36.27 per share.
The calculation of diluted net income (loss) per share excludes all anti-dilutive common shares. For periods in which the
Company has reported net losses, diluted net loss per share attributable to common stockholders is the same as basic net loss
per share attributable to common stockholders, because dilutive common shares are not assumed to have been issued if their
effect is anti-dilutive.
103
Etsy, Inc.
Notes to Consolidated Financial Statements
Segment Data
The Company identifies operating segments as components of an entity for which discrete financial information is available and
is regularly reviewed by the chief operating decision maker, or decision-making group, in making decisions regarding resource
allocation and performance assessment. The Company defines the term “chief operating decision maker” to be its chief
executive officer. The Company has determined it operates in one operating segment and one reportable segment, as its chief
operating decision maker reviews financial information presented on only a consolidated basis for purposes of allocating
resources and evaluating financial performance.
Cash, Cash Equivalents, and Short-term Investments
The Company considers all investments with an original maturity of three months or less at time of purchase to be cash
equivalents. Cash restricted by third parties is not considered cash and cash equivalents. Short-term investments, consisting
primarily of commercial paper, U.S. Government and agency securities, and corporate bonds with original maturities of greater
than three months but less than one year when purchased, are classified as available-for-sale and are reported at fair value using
the specific identification method. Unrealized gains and losses are excluded from earnings and reported as a component of other
comprehensive income (loss), net of related estimated income tax provisions or benefits.
The following table provides cash, cash equivalents, and short-term investments within the Consolidated Balance Sheets as of
the dates indicated (in thousands):
Cash and cash equivalents
Short-term investments
Total cash, cash equivalents, and short-term investments
Concentration of Credit Risk
As of December 31,
2018
2017
$
$
366,985
$
257,302
624,287
$
315,442
25,108
340,550
Financial instruments that potentially subject the Company to concentrations of credit risk consist of cash and cash equivalents,
short-term investments, and funds receivable and seller accounts. The Company reduces credit risk by placing its cash and cash
equivalents with major financial institutions with high credit ratings. At times, such amounts may exceed federally insured
limits. In addition, funds receivable are generated primarily with credit card and payment processing companies which
management believes are of high credit quality.
Fair Value of Financial Instruments
Management believes that the fair value of financial instruments, consisting of cash and cash equivalents, short-term
investments, accounts receivable, funds receivable and seller accounts, accounts payable, and funds payable and seller accounts
approximates carrying value due to the immediate or short-term maturity associated with these instruments.
In accounting for the issuance of the Notes discussed in “Note 13—Debt,” management used estimates and assumptions to
calculate the carrying amounts of the liability and equity components by measuring the fair value of similar securities.
Accounts Receivable and Allowance for Doubtful Accounts
The Company’s trade accounts receivable are recorded at amounts billed to Etsy sellers and are presented on the Consolidated
Balance Sheet net of the allowance for doubtful accounts. The allowance is determined by a number of factors, including age of
the receivable, current economic conditions, historical losses, and management’s assessment of the financial condition of Etsy
sellers. Receivables are written off once they are deemed uncollectible, which may arise when Etsy sellers file for bankruptcy
or are otherwise deemed unable to repay the amounts owed to the Company. Estimates of uncollectible accounts receivable are
recorded to general and administrative expense. See “Note 2—Revenue” for additional information on payment terms related to
the Company’s accounts receivable balances.
104
Etsy, Inc.
Notes to Consolidated Financial Statements
The following table summarizes the allowance activity during the periods indicated (in thousands):
Balance as of the beginning of period
Bad debt expense
Write-offs, net of recoveries and other adjustments
Balance as of the end of period
Year Ended
December 31,
2018
2017
2016
$
$
2,687
$
1,999
$
4,124
(2,091)
2,497
(1,809)
4,720
$
2,687
$
2,071
1,770
(1,842)
1,999
Funds Receivable and Seller Accounts and Funds Payable and Amounts due to Sellers
The Company records funds receivable and seller accounts and funds payable and amounts due to sellers as current assets and
liabilities, respectively, on the Consolidated Balance Sheet. Funds receivable and seller accounts represent amounts received or
expected to be received from Etsy buyers via third-party credit card processors, which flow through an Etsy bank account for
payment to Etsy sellers. This cash and related receivable represent the total amount due to sellers, and as such a liability for the
same amount is recorded to funds payable and amounts due to Etsy sellers.
Property and Equipment
Property and equipment, consisting principally of building, capitalized website development and internal-use software,
leasehold improvements, and computer equipment, are recorded at cost. The Company capitalizes construction in progress for
build-to-suit lease agreements where we are the owner, for accounting purposes only, during the construction period.
Depreciation and amortization begin at the time the asset is placed into service and are recognized using the straight-line
method in amounts sufficient to relate the cost of depreciable and amortizable assets to the Consolidated Statements of
Operations over their estimated useful lives. Repairs and maintenance are charged to the Consolidated Statements of Operations
as incurred. Upon sale or retirement of assets, the cost and related accumulated depreciation or amortization are removed from
the balance sheet and the resulting gain or loss is reflected in the Consolidated Statements of Operations.
When events or changes in circumstances require, the Company assesses the likelihood of recovering the cost of tangible long-
lived assets based on its expectations of future profitability, undiscounted cash flows, and management’s plans with respect to
operations to determine if the asset is impaired and subject to write-off. Measurement of any impairment loss is based on the
excess of the carrying value of the asset over the fair value. See “Recently Issued Accounting Pronouncements” below for
information on the impact of ASU 2016-02—Leases on property and equipment balances.
Website Development and Internal-use Software Costs
Costs incurred to develop the Company’s website and software for internal-use are capitalized and amortized over the estimated
useful life of the software, generally three to five years. In accordance with authoritative accounting guidance, capitalization of
costs to develop software begin when preliminary development efforts are successfully completed, management has authorized
and committed project funding, and it is probable that the project will be completed and the software will be used as intended.
The Company also capitalizes costs related to upgrades and enhancements when it is probable the expenditures will result in
additional functionality or will extend the useful life of existing functionality. Costs related to the design or maintenance of
website development and internal-use software are expensed as incurred. The Company periodically reviews capitalized
website development and internal-use software costs to determine whether the projects will be completed, placed in service,
removed from service, or replaced by other internally-developed or third-party software. If an asset is not expected to provide
any future use, the asset is retired and any unamortized cost is expensed.
If an asset will continue to be used, but the net book value is not expected to be fully recoverable, the asset is impaired to its fair
value. When events or changes in circumstances require, the Company assesses the likelihood of recovering the cost of website
development and internal-use software costs based on its expectations of future profitability, undiscounted cash flows, and our
plans with respect to operations to determine if the asset is impaired and subject to write-off. Measurement of any impairment
loss is based on the excess of the carrying value of the asset over the fair value. No impairment of capitalized website
development and internal-use software assets was recorded during the years ended December 31, 2018 and 2016. The Company
105
Etsy, Inc.
Notes to Consolidated Financial Statements
recognized an asset impairment charge of $3.2 million related to capitalized web development and internal-use software assets
in the year ended December 31, 2017 as a result of its decision to discontinue certain product offerings, including Etsy Studio
and Etsy Manufacturing.
Capitalized website development and internal-use software costs are included in property and equipment within the
Consolidated Balance Sheets.
Asset Acquisitions
The Company has completed asset acquisitions and may complete additional asset acquisitions in the future. In an asset
acquisition, the Company initially determines whether it acquired a single or group of assets. Acquired assets are recognized
based on the purchase price, which is presumed to equal the fair value of the net assets acquired and amortized in the period
over which the asset is expected to contribute directly or indirectly to the future cash flows of that entity. When circumstances
indicate that the carrying value of these assets may not be recoverable, the Company reviews its identifiable amortizable
intangible assets for impairment. The Company accrues for contingent consideration when payout becomes probable and is
reasonably estimable.
Business Combinations
The Company has completed a number of acquisitions of other businesses in the past and may acquire additional businesses or
technologies in the future. In an acquisition, the Company first reviews if substantially all of the fair value of the assets acquired
is concentrated in a single identifiable asset or group of similar identifiable assets, in which case the set is not considered a
business and is accounted for as an asset acquisition.
The results of businesses acquired in a business combination are included in the Company’s Consolidated Financial Statements
from the date of acquisition. The Company allocates the purchase price, which is the sum of the consideration provided and
may consist of cash, equity, or a combination of the two, in a business combination to the identifiable assets and liabilities of
the acquired business at their acquisition date fair values. The excess of the purchase price over the amount allocated to the
identifiable assets and liabilities, if any, is recorded as goodwill. Determining the fair value of assets acquired and liabilities
assumed requires management to use significant judgment and estimates, including the selection of valuation methodologies,
estimates of future revenue and cash flows, discount rates, and selection of comparable companies.
When the Company issues stock-based or cash awards to an acquired company’s stockholders, the Company evaluates whether
the awards are contingent consideration or compensation for post-combination services. The evaluation includes, among other
things, whether the vesting of the awards is contingent on the continued employment of the acquired company’s stockholder
beyond the acquisition date. If continued employment is required for vesting, the awards are treated as compensation for post-
combination services and recognized as expense over the requisite service period.
The Company initially recognizes intangible assets at fair value, and amortizes them on a straight-line basis over their estimated
useful lives. When circumstances indicate that the carrying value of these assets may not be recoverable, the Company reviews
its identifiable amortizable intangible assets for impairment.
To date, the assets acquired and liabilities assumed in the Company’s business combinations have primarily consisted of
goodwill and finite-lived intangible assets, consisting primarily of developed technologies, customer relationships, and
trademarks. The estimated fair values and useful lives of identifiable intangible assets are based on many factors, including
estimates and assumptions of future operating performance and cash flows of the acquired business, the nature of the business
acquired, and the specific characteristics of the identified intangible assets. The estimates and assumptions used to determine
the fair values and useful lives of identified intangible assets could change due to numerous factors, including market
conditions, technological developments, economic conditions, and competition. In connection with determination of fair values,
the Company may engage independent appraisal firms to assist with the valuation of intangible and certain tangible assets
acquired and certain assumed obligations.
Acquisition-related transaction costs incurred by the Company are not included as a component of consideration transferred, but
are accounted for as an expense in the period in which the costs are incurred.
106
Etsy, Inc.
Notes to Consolidated Financial Statements
Goodwill
Goodwill represents the excess of the aggregate fair value of the consideration transferred in a business combination over the
fair value of the assets acquired, net of liabilities assumed. Goodwill is not amortized, but is subject to an annual impairment
test. Management has determined that the Company has a single reporting unit and performs its annual goodwill impairment
test during the fourth quarter or more frequently if events or changes in circumstances indicate that the goodwill may be
impaired.
Events or changes in circumstances which could trigger an impairment review include significant changes in the manner of the
Company’s use of the acquired assets or the strategy for the Company’s overall business, significant negative industry or
economic trends, significant underperformance relative to historical or projected future results of operations, a significant
adverse change in the business climate, cost factors that have a negative effect on earnings and cash flows, an adverse action or
assessment by a regulator, a sustained decrease in share price, unanticipated competition, or a loss of key personnel.
The Company has the option to first assess qualitative factors to determine whether the existence of events or circumstances
leads to a determination that it is more likely than not that the fair value of the reporting unit is less than its carrying amount. If,
after assessing the totality of events or circumstances, the Company determines it is not more likely than not that the fair value
of the reporting unit is less than its carrying amount, then additional impairment testing is not required. However, if the
Company concludes otherwise, then it is required to perform a quantitative assessment for impairment.
The quantitative assessment involves comparing the estimated fair value of the reporting unit with its respective book value,
including goodwill. If the estimated fair value exceeds book value, goodwill is considered not to be impaired and no additional
steps are necessary. If, however, the book value of the reporting unit exceeds the fair value, an impairment loss is recognized in
an amount equal to the excess, not to exceed the total amount of goodwill allocated to that reporting unit.
The Company completed a qualitative analysis during the fourth quarter of 2018. No impairment of goodwill was recorded
during the three years ended December 31, 2018, 2017, and 2016.
Intangible Assets
Intangible assets are amortized over the estimated useful life of the asset. The estimated useful lives of acquired technology,
customer relationships, and trademarks are generally three years and the estimated useful life of the referral agreement is ten
years. When events or changes in circumstances require, the Company assesses the likelihood of recovering the cost of
intangible assets based on its expectations of future profitability, undiscounted cash flows, and management’s plans with respect
to operations to determine if the asset is impaired and subject to write-off. Measurement of any impairment loss is based on the
excess of the carrying value of the asset over the fair value. No impairment of intangible assets was recorded during the two
years ended December 31, 2018 and 2017. The Company recognized an asset impairment charge of $0.6 million in the year
ended December 31, 2016, related to the impairment of nonrecoverable intangible assets acquired in the ALM and Jarvis Labs,
Inc. acquisitions for customer relationships and trademarks.
Leases
The Company leases office space and certain computer equipment in multiple locations under non-cancelable lease agreements.
The leases are reviewed for classification as operating, capital, or build-to-suit leases. For operating leases, rent is recognized
on a straight-line basis over the lease period. For capital leases, the Company records the leased asset with a corresponding
liability. Payments are recorded as reductions to the liability with an appropriate interest charge recorded based on the then-
outstanding remaining liability. Upon adoption of ASU 2016-02—Leases, the Company will recognize additional operating
liabilities and corresponding right-of-use assets of the same amount based on the present value of the remaining minimum
rental payments under current leasing standards for existing operating leases.
The Company considers the nature of the renovations and the Company’s involvement during the construction period of newly-
leased office space to determine if it is considered, for accounting purposes only, to be the owner of the construction project
during the construction period. If the Company determines that it is the owner of the construction project, it is required to
capitalize the fair value of the building as well as the construction costs incurred on its Consolidated Balance Sheet along with a
corresponding financing liability (“build-to-suit accounting”). Upon occupancy for build-to-suit leases, the Company assesses
107
Etsy, Inc.
Notes to Consolidated Financial Statements
whether the circumstances qualify for sales recognition under the sale-leaseback accounting guidance. If the lease meets the
sale-leaseback criteria, the Company will remove the asset and related financial obligation from the balance sheet and treat the
building lease as an operating lease. If upon completion of construction, the project does not meet the sale-leaseback criteria,
the leased property will be treated as a capital lease for financial reporting purposes.
In May 2016, the Company took possession of its corporate headquarters in Brooklyn, New York upon substantial completion
of the construction phase of the build-out. Upon completion of the project, the Company performed a sale-leaseback analysis
pursuant to Accounting Standards Codification (“ASC”) 840—Leases, to determine the appropriateness of removing the
previously capitalized assets from the Consolidated Balance Sheets. The Company concluded that components of “continuing
involvement” were evident as a result of this review, precluding the derecognition of the related assets from the Consolidated
Balance Sheets. In conjunction with the initiation of the lease in May 2014, the Company also recorded a facility financing
obligation equal to the fair market value of the assets received from the landlord. As of December 31, 2018, the facility
financing obligation outstanding was $60.0 million. The Company does not report rent expense for the lease. Rather, rental
payments under the lease are recognized as a reduction of the financing obligation and interest expense, and the associated asset
capitalized throughout the construction project is depreciated over its estimated useful life. Upon adoption of ASU 2016-02—
Leases, the Company will derecognize the facility financing obligation and any gains or losses associated with this change in
accounting will be recognized through a cumulative-effect adjustment to accumulated deficit as of January 1, 2019.
Additionally, a new right-of-use asset and lease liability will be recognized on the Consolidated Balance Sheet for the
associated lease. See “Recently Issued Accounting Pronouncements” below for additional information on the impact of ASU
2016-02—Leases.
Contingencies
The Company accrues for loss contingencies when losses become probable and are reasonably estimable. If the reasonable
estimate of the loss is a range and no amount within the range is a better estimate, the minimum amount of the range is recorded
as a liability. The Company does not accrue for contingent losses that, in its judgment, are considered to be reasonably possible,
but not probable; however, it discloses the range of such reasonably possible losses.
Recently Issued Accounting Pronouncements
In February 2016, the Financial Accounting Standards Board (“FASB”) issued ASU 2016-02—Leases, and additional changes,
modifications, clarifications, or interpretations related to this guidance thereafter, which require a reporting entity to recognize
right-of-use assets and lease liabilities on the balance sheet for operating leases to increase transparency and comparability. The
new guidance is effective for annual and interim periods beginning after December 15, 2018, and early adoption is permitted.
The Company will adopt this guidance on a modified retrospective basis as of January 1, 2019, utilizing transition guidance
introduced in ASU 2018-11—Leases: Targeted Improvements and expects to elect the ‘package of practical expedients,’ which
permits the Company not to reassess prior conclusions about lease identification, classification and initial direct costs. The
Company does not expect to elect the use-of-hindsight or the practical expedient pertaining to land easements; the latter not
being applicable.
The Company has not yet finalized the review, however, the Company is expecting that this standard will have a material effect
on the Company’s Consolidated Financial Statements. The most significant effects relate to the recognition of new right-of-use
assets and lease liabilities on the Consolidated Balance Sheet for real estate operating leases; the derecognition of existing
assets and liabilities for a sale-leaseback transaction (arising from a build-to-suit lease arrangement on our Brooklyn
headquarters for which construction is complete and the Company is leasing the constructed asset) that currently does not
qualify for sale accounting; and providing significant new disclosures about leasing activities. However, the Company does not
expect adoption to have a material impact on its results of operations or liquidity. The accounting for capital leases is expected
to remain substantially unchanged. Upon adoption, the Company will:
•
•
recognize additional operating liabilities and corresponding right-of-use assets of the same amount based on the
present value of the remaining minimum rental payments under current leasing standards for existing operating leases;
derecognize existing facility financing obligations and the related existing building asset for our corporate
headquarters. Any gains or losses associated with this change in accounting will be recognized through a cumulative-
effect adjustment to accumulated deficit as of January 1, 2019. Additionally, a new right-of-use asset and lease liability
108
Etsy, Inc.
Notes to Consolidated Financial Statements
will be recognized on the Consolidated Balance Sheet for the associated lease, which will be classified as a financing
lease.
The new standard also provides practical expedients for an entity’s ongoing accounting. The Company will elect the short-term
lease recognition exemption for all leases that qualify. Accordingly, we will not recognize right-of-use assets or lease liabilities
for leases that qualify, including leases for existing short-term leases in effect at transition and will recognize those payments on
the Consolidated Statements of Operations on a straight-line basis over the lease term. The Company will elect the practical
expedient to not separate lease and non-lease components for all its leases.
In January 2016, the FASB issued ASU 2016-13—Financial Instruments—Credit Losses, and additional changes,
modifications, clarifications or interpretations related to this guidance thereafter, which require a reporting entity to estimate
credit losses on certain types of financial instruments, and present assets held at amortized cost and available-for-sale debt
securities at the amount expected to be collected. The new guidance is effective for annual and interim periods beginning after
December 15, 2019, and early adoption is permitted. The Company is currently evaluating the impact of the new guidance on
its Consolidated Financial Statements.
In July 2018, FASB issued ASU 2018-09—Codification Improvements, which clarifies, corrects, and makes minor
improvements across multiple topics in the codification. The transition and effective dates are based on the facts and
circumstances of each amendment, with some amendments becoming effective upon issuance of the update, and others
becoming effective for annual periods beginning after December 15, 2018. The amendments that were effective upon issuance
of the update did not have an impact on the Company’s Consolidated Financial Statements. The Company is currently
evaluating the impact of the adoption of the other amendments on its Consolidated Financial Statements.
In August 2018, the FASB issued ASU 2018-15—Customer’s Accounting for Implementation Costs Incurred in a Cloud
Computing Arrangement That Is a Service Contract, which aligns the requirements for capitalizing implementation costs
incurred in a hosting arrangement that is a service contract with the requirements for capitalizing implementation costs incurred
to develop or obtain internal-use software. The new guidance is effective for annual and interim periods beginning after
December 15, 2019, and early adoption is permitted. The Company is currently evaluating the impact of the adoption of the
new guidance on its Consolidated Financial Statements.
Recently Adopted Accounting Pronouncements
In May 2014, the FASB issued ASU 2014-09—Revenue from Contracts with Customers, and additional changes, modifications,
clarifications, or interpretations related to this guidance thereafter, which replaces existing revenue recognition guidance. The
new guidance was effective for the annual and interim periods beginning after December 15, 2017. Among other things, the
updated guidance requires companies to recognize revenue in a way that depicts the transfer of promised goods or services to
customers in an amount that reflects the consideration to which the entity expects to be entitled in exchange for those goods or
services. The Company adopted the requirements of the new guidance as of January 1, 2018, utilizing the full retrospective
method of transition. In connection with the adoption, the company reclassified Etsy Payments revenue from Services revenue
to Marketplace revenue in the Consolidated Statements of Operations. Aside from this presentation reclassification, adoption of
the new guidance did not result in changes to the prior year or current year Consolidated Financial Statements. See “Revenue
Recognition” above and Note 2—Revenue” for additional information regarding revenue recognition.
In November 2016, the FASB issued ASU 2016-18—Statement of Cash Flows: Restricted Cash, which requires that a statement
of cash flows explain the change during the period in the total of cash, cash equivalents, and amounts generally described as
restricted cash or restricted cash equivalents. The new guidance is effective for the annual and interim periods beginning after
December 15, 2017. The Company adopted this standard in the first quarter of 2018 utilizing the full retrospective method of
transition. As a result of this guidance, the Company reclassified $5.3 million on the Consolidated Statement of Cash Flows in
the year ended December 31, 2018, 2017, and 2016 to include restricted cash in the beginning and ending cash, cash
equivalents, and restricted cash balances.
109
Etsy, Inc.
Notes to Consolidated Financial Statements
The following table provides a reconciliation of cash, cash equivalents, and restricted cash reported within the Consolidated
Balance Sheets that sum to the total of the same such amounts shown in the Consolidated Statement of Cash Flows (in
thousands):
Beginning balance:
Cash and cash equivalents
Restricted cash
Total cash, cash equivalents, and restricted cash
Ending balance:
Cash and cash equivalents
Restricted cash
Total cash, cash equivalents, and restricted cash
Year Ended December 31,
2018
2017
2016
$
$
$
$
315,442
$
181,592
5,341
5,341
320,783
$
186,933
366,985
$
315,442
5,341
5,341
372,326
$
320,783
$
$
$
$
271,244
5,341
276,585
181,592
5,341
186,933
The balances included in restricted cash represent amounts held as collateral associated with the lease of the Company’s
Brooklyn, New York headquarters. This standard had no other impact to the Consolidated Financial Statements.
In June 2018, the FASB issued ASU 2018-07—Improvements to Nonemployee Share-Based Payment Accounting, which
expands the scope of ASC Topic 718—Compensation—Stock Compensation, to include share-based payment transactions for
acquiring goods and services from non-employees. The new guidance is effective for annual and interim periods beginning after
December 15, 2018, and early adoption is permitted. The Company adopted this standard in the third quarter of 2018 noting
that the adoption of the standard had no material impact on its Consolidated Financial Statements.
In August 2018, the FASB issued ASU 2018-13—Disclosure Framework—Changes to the Disclosure Requirements for Fair
Value Measurement, which adds, modifies, and removes various disclosure requirements for fair value measurements. The new
guidance is effective for annual and interim periods beginning after December 15, 2019, and early adoption is permitted. The
Company adopted this standard in the third quarter of 2018 noting that the adoption of the standard had no impact on its fair
value measurement disclosures.
Note 2—Revenue
The following table summarizes revenue by type of service for the periods presented (in thousands):
Marketplace revenue (1)
Services revenue
Other revenue
Revenue
Year Ended December 31,
2018
2017
2016
$
$
440,740
$
326,076
$
269,628
158,928
4,025
111,869
3,286
89,433
5,906
603,693
$
441,231
$
364,967
(1) Etsy Payments revenue for the years ended December 31, 2018, 2017, and 2016 has been reclassified and presented
within Marketplace revenue. Comparative periods have been reclassified to conform to current period presentation.
See “Note 1—Basis of Presentation and Summary of Significant Accounting Policies —Revenue Recognition” for additional
information on recognition.
110
Etsy, Inc.
Notes to Consolidated Financial Statements
Payment terms
As of November 13, 2018, for Etsy sellers using Etsy Payments, all charges, including listing fees, transaction fees, Etsy
Payments fees, Promoted Listings fees, Etsy Shipping Labels fees, Pattern fees, Etsy Plus fees, are deducted from the funds
credited to the seller’s shop payment account in the seller’s ledger currency prior to settlement of those funds to the seller’s
bank account. Etsy sellers receive a statement electronically on the first day of each month outlining the previous month’s
charges and any remaining amount due after the Company’s fees are deducted from the seller’s shop payment account. Etsy
sellers that do not use Etsy Payments receive a statement electronically on the first day of each month for the previous month’s
charges in U.S. Dollars, including all listing fees, transactions fees, Promoted Listing fees, Etsy Shipping Labels fees, Pattern
fees, and Etsy Plus fees. Payment is due by the 15th of every month.
Prior to November 13, 2018, Etsy sellers would receive a statement electronically on the first day of each month for the
previous month’s charges in U.S. Dollars, including all listing fees, transactions fees, Promoted Listing fees, Etsy Shipping
Labels fees, Pattern fees, and Etsy Plus fees. Payment was due by the 15th of every month. Prior to November 13, 2018 only
Etsy Payments fees were deducted from the funds credited to the seller’s shop payment account in the seller’s ledger currency
prior to settlement of those funds to the seller’s bank account.
Contract balances
Deferred revenues
The Company records deferred revenues when cash payments are received or due in advance of the completion of the listing or
subscription period, which represents the value of the Company’s unsatisfied performance obligations. Deferred listing revenue
is recognized ratably over the remainder of the four-month listing period, unless the item is sold or the seller re-lists it, at which
time any remaining listing fee is recognized.
Deferred Etsy Plus subscription revenues related to the enhanced features described in “Note 1—Basis of Presentation and
Summary of Significant Accounting Policies —Revenue Recognition” are recognized ratably over the 30-day subscription
period. Credits for Promoted Listings are recognized when used, or when the 30-day subscription period expires. Credits for
listing fees are recognized over the four-month listing period when used, and any unused credits are recognized when the 30-
day subscription period expires. The amount of revenue recognized in the year ended December 31, 2018 that was included in
the deferred balance at the beginning of the period was $6.3 million.
Significant judgments
Judgment is required to assess the nature of the services that the Company promises to its customers and the timing of
satisfaction of those promised services.
For services that are refundable, the Company accounts for the right of return as a refund liability and reduction of revenue
recognized in the amount of refunds that are expected to be issued. Refunds are estimated monthly, are based on historical
refund patterns, and are updated at the end of each reporting period as additional information becomes available.
Note 3—Income Taxes
The following are the domestic and foreign components of the Company’s income (loss) before income taxes (in thousands):
Domestic
Foreign
Income (loss) before income taxes
Year Ended
December 31,
2018
2017
2016
$
$
36,157
$
(16,583) $
18,921
48,848
55,078
$
32,265
$
25,910
(28,786)
(2,876)
111
Etsy, Inc.
Notes to Consolidated Financial Statements
The income tax (benefit) provision is comprised of the following (in thousands):
Current:
Federal
State
Foreign
Total current
Deferred:
Federal
State
Foreign
Total deferred
Total income tax (benefit) provision
Year Ended
December 31,
2018
2017
2016
$
709
$
(6,397) $
22,084
(578)
600
731
(3,343)
3,496
(23,297)
(23,144)
79
476
(5,842)
(34,948)
(8,778)
33
(43,693)
$
(22,413) $
(49,535) $
2,623
580
25,287
2,008
(247)
(23)
1,738
27,025
Beginning in the first quarter of 2017, the Company adopted ASU 2016-09—Stock Compensation: Improvements to Employee
Share-based Payment Accounting, and subsequently recorded excess tax deductions on share-based compensation as income
tax benefit in its income statement. The current tax expense listed above does not reflect income tax benefits of $3.2 million for
the year ended December 31, 2016 related to excess tax deductions on share-based compensation because these benefits were
recorded directly to additional paid-in capital. Please refer to “Note 1—Basis of Presentation and Summary of Significant
Accounting Policies—Excess Tax Benefits from Exercise of Stock Options” for additional detail regarding the adoption of this
accounting standard and its impact on the Consolidated Financial Statements.
A reconciliation of the income tax (benefit) provision at the U.S. federal statutory income tax rate of 21% in 2018 and 35% in
2017 and 2016 to the Company’s total income tax (benefit) provision is as follows (in thousands):
Income tax provision (benefit) at federal statutory rate
State and local taxes net of federal benefit
Foreign income tax rate differential
Stock-based compensation
Non-deductible items
Uncertain tax positions
Return to provision adjustment
Non-deductible acquisition costs
Change in valuation allowance
Research and development credit
Deferred charge on restructuring
U.S. tax reform
Other
Year Ended
December 31,
2018
2017
2016
$
11,566
$
11,308
$
(1,007)
3,839
(298)
(11,717)
(329)
382
3,293
—
(28,733)
(4,115)
—
3,897
(198)
(691)
(11,878)
(12,584)
168
789
167
—
(4,673)
(1,098)
—
(31,063)
20
1,545
5,849
1,412
267
4,033
(498)
199
4,911
(2,170)
12,168
—
316
Total income tax (benefit) provision
$
(22,413) $
(49,535) $
27,025
On December 22, 2017, the U.S. government enacted the TCJA, as described above, which includes significant changes to the
taxation of business entities. These changes include, among others, (1) a permanent reduction to the corporate income tax rate,
(2) a partial limitation on the deductibility of business interest expense (“163(j) Interest Limitation”), and (3) a shift of the U.S.
taxation of multinational corporations from a tax on worldwide income to a quasiterritorial system (along with certain rules
designed to prevent erosion of the U.S. income tax base).
112
Etsy, Inc.
Notes to Consolidated Financial Statements
Effective January 1, 2018, the Company is subject to several provisions of the TCJA including computations under GILTI and
Foreign Derived Intangible Income (“FDII”). The Company does not currently meet the revenue threshold for the Base Erosion
and Anti-Abuse Tax (“BEAT”). For the GILTI and FDII computations, the Company recorded tax expense using the current
available regulations and technical guidance on the interpretations of the TCJA. As required by SEC Staff Accounting Bulletin
118, Income Tax Accounting Implications of the Tax Cuts and Jobs Act, we have finalized our accounting analysis based on the
guidance and regulations available as of December 31, 2018. We have recorded the impacts of the TCJA in our effective tax
rate and have elected to treat taxes due on future U.S. inclusions in taxable income related to GILTI using the period cost
method. The Company will continue to monitor the forthcoming regulations and additional guidance of the GILTI, FDII, and
BEAT provisions under the TCJA, which are complex and subject to continuing regulatory interpretation by the IRS.
A secondary driver of the income tax provision for the year ended December 31, 2018 and December 31, 2017 was the
recognition of excess tax benefits from stock-based compensation as a result of the adoption of ASU 2016-09—Stock
Compensation: Improvements to Employee Share-based Payment Accounting in the first quarter of 2017. As a result of this
updated guidance, we recorded $12.0 million and 12.8 million of excess tax benefits, rather than additional paid-in capital, for
the years ended December 31, 2018 and 2017.
The primary driver of the income tax benefit for the year ended December 31, 2017 was the impact on deferred taxes from the
reduction in the U.S. federal corporate tax rate beginning in 2018. On December 22, 2017, the TCJA was signed into law,
which, among other items, reduced the corporate income tax rate from 35% to 21%. As a result, our deferred taxes and certain
unrecognized tax benefits at December 31, 2017 have been revalued at the reduced 21% rate. The revaluation resulted in a
benefit for income taxes of approximately $31.1 million for the year ended December 31, 2017.
Deferred income taxes reflect the net tax effect of temporary differences between the carrying amounts of assets and liabilities
for financial reporting purposes and the amounts used for income tax purposes. Significant components of the Company’s
deferred tax assets (liabilities) are as follows (in thousands):
Deferred tax assets:
Net operating loss carryforwards
Amortization of acquired intangibles
Research and development credit carryforwards
Stock-based compensation expense
Accrued VAT liability
Alternative minimum tax credit
Allowance for doubtful accounts
Deferred rent
Accrued vacation
Unrealized loss on foreign currency
Other, net
Total deferred tax assets
Less valuation allowance
Total net deferred tax asset
Deferred tax liabilities:
Depreciation
Global corporate restructuring liability
Convertible debt
Unrealized gain on foreign currency
Other liabilities
Total deferred tax liabilities
Net deferred tax liabilities
As of December 31,
2018
2017
$
13,347
$
12,109
7,567
6,623
43
274
545
529
744
—
1,301
43,082
1,673
41,409
(6,933)
(33,730)
(7,283)
(92)
(362)
$
(48,400)
(6,991) $
113
24,625
15,631
3,597
3,776
42
274
384
573
623
527
300
50,352
32,455
17,897
(6,850)
(33,783)
—
—
(891)
(41,524)
(23,627)
Etsy, Inc.
Notes to Consolidated Financial Statements
The 2017 deferred tax balances have been revised to correct the Company’s disclosures related to the adoption of ASU 2016-16
—Income Taxes: Intra-entity Transfers of Assets other than Inventory. The revision increases both the deferred tax assets and
valuation allowance by $21.4 million resulting in no change to the net deferred tax asset. The Company has concluded that this
disclosure omission was not material to the 2017 Consolidated Financial Statements.
The Company anticipates utilizing federal and state income tax NOL carryforwards as a result of its 2018 activity. The NOL
deferred tax asset balance additionally includes losses in certain foreign jurisdictions that are currently subject to a valuation
allowance.
As of December 31, 2018 and 2017, the Company had $7.6 million and $3.6 million, respectively, of federal research and
development tax credit carryforwards which will begin to expire in 2035 if unused.
The Company assesses the likelihood of its ability to realize the benefit of its deferred tax assets in each jurisdiction by
evaluating all relevant positive and negative evidence at each reporting date. To the extent the Company determines that some
or all of its deferred tax assets are not more likely than not to be realized, it establishes a valuation allowance. For the year
ended December 31, 2018, in part because in the current year, the Company achieved three years of cumulative pre-tax income
in certain of its foreign jurisdictions, management determined that sufficient positive evidence exists as of December 31, 2018,
to conclude that is is more likely than not that deferred tax assets of $23.4 million will be utilized in those jurisdictions.
Additionally, the Company determined that the existence of a three-year cumulative loss incurred in certain other foreign
jurisdictions, inclusive of 2018, constituted sufficiently strong negative evidence to warrant the maintenance of a valuation
allowance. As a result, a valuation allowance of $1.7 million as of December 31, 2018 has been recorded against certain of the
Company’s deferred tax assets. The amount of the deferred tax assets considered realizable is $41.4 million.
The following table summarizes the valuation allowance activity for the periods indicated (in thousands). It has been revised to
reflect the Company’s adoption of ASU 2016-16—Income Taxes: Intra-entity Transfers of Assets other than Inventory:
Balance as of the beginning of period
Additions charged to expense
Deletions credited to expense
Currency translation
Balance as of the end of period
Year Ended
December 31,
2018
2017
2016
$
$
32,455
$
13,839
$
—
(28,733)
(2,049)
16,743
—
1,873
9,540
4,886
—
(587)
1,673
$
32,455
$
13,839
The Company has not recorded deferred income taxes and withholding taxes with respect to undistributed earnings from its
non-U.S. subsidiaries as such earnings are intended to be reinvested indefinitely. The amount of undistributed earnings of non-
U.S. subsidiaries at December 31, 2018, as well as the related deferred income tax, if any, is not material.
The following table summarizes the unrecognized tax benefit activity for the periods indicated (in thousands):
Balance as of the beginning of period
Additions based on tax positions related to the current year
Additions for tax positions of prior years
Reductions for tax provisions of prior years
Balance as of the end of period
As of December 31,
2018
2017
2016
$
$
17,013
$
23,574
$
921
946
(61)
732
118
(7,411)
22,229
1,071
274
—
18,819
$
17,013
$
23,574
The amount of unrecognized tax benefits included on the Consolidated Balance Sheets as of December 31, 2018, 2017, and
2016 are $18.8 million, $17.0 million, and $23.6 million, respectively. The total amount of unrecognized tax benefits that, if
recognized, would favorably affect the effective tax rate is $18.8 million at December 31, 2018.
114
Etsy, Inc.
Notes to Consolidated Financial Statements
We recognize interest and/or penalties related to uncertain tax positions in income tax expense. In 2018, $0.3 million was
included in tax expense for interest and penalties. The amount of interest and penalties accrued as of December 31, 2018 and
2017 was approximately $0.5 million and $0.2 million, respectively.
In January 2015, the Company implemented an updated global corporate structure to more closely align with its global
operations and future expansion plans outside of the United States. The new structure changed how the Company uses its
intellectual property and implemented certain intercompany arrangements. The Company believes this may eventually result in
a reduction in its overall effective tax rate and other operational efficiencies. The revised structure resulted in the setup of a
deferred tax liability in the amount of $66.0 million on the taxable gain created in the transaction. Concurrently, the Company
recorded an asset of $66.0 million for the deferred tax charge representing the future income tax on the gain, which would have
been amortized into income tax expense through 2019. During the first quarter of 2017, the Company adopted ASU 2016-16—
Income Taxes: Intra-entity Transfers of Assets other than Inventory, resulting in a cumulative adjustment to retained earnings
for the unamortized balance of the deferred tax charge at December 31, 2016.
The Company is subject to taxation in the United States, New York, and various other states and foreign jurisdictions. As of
December 31, 2018, tax year 2014 and later remain open to examination.
Note 4—Net Income (Loss) Per Share
The following table presents the calculation of basic and diluted net income (loss) per share for periods presented (in thousands
except share and per share amounts):
Numerator:
Net income (loss)
Net income (loss) allocated to participating securities under the two-class method
Net income (loss) applicable to common stockholders—basic
Dilutive effect of net income allocated to participating securities under the two-class method
Change in fair value of liability classified restricted stock
Year Ended
December 31,
2018
2017
2016
$
77,491
$
81,800
$
(29,901)
(37)
77,454
37
—
(80)
81,720
80
771
—
(29,901)
—
—
Net income (loss) applicable to common stockholders—diluted
$
77,491
$
82,571
$
(29,901)
Denominator:
Weighted average common shares outstanding—basic (1)
120,146,076
118,538,687
113,562,738
Dilutive effect of assumed conversion of options to purchase common stock
Dilutive effect of assumed conversion of restricted stock units
Dilutive effect of assumed conversion of convertible debt
Diluted effective of assumed conversion of restricted stock from acquisition
4,238,622
1,721,658
900,580
77,849
2,498,448
1,177,799
—
52,739
—
—
—
—
Weighted average common shares outstanding—diluted
127,084,785
122,267,673
113,562,738
Net income (loss) per share applicable to common stockholders—basic
Net income (loss) per share applicable to common stockholders—diluted
$
$
0.64
0.61
$
$
0.69
0.68
$
$
(0.26)
(0.26)
(1) 57,482 shares of unvested stock are considered participating securities and are excluded from basic shares outstanding
for the year ended December 31, 2018.
115
Etsy, Inc.
Notes to Consolidated Financial Statements
The following potential common shares were excluded from the calculation of diluted net income (loss) per share attributable to
common stockholders because their effect would have been anti-dilutive for the periods presented:
Stock options
Restricted stock units
Warrants
Total anti-dilutive securities
Note 5—Business Combinations
Year Ended
December 31,
2018
2017
2016
475,238
136,998
—
4,902,664
10,041,403
435,358
2,043,544
—
33,447
612,236
5,338,022
12,118,394
On September 19, 2016, the Company acquired all of the outstanding common stock of Blackbird Technologies Inc
(“Blackbird”), a machine learning company, for $32.5 million. The Company completed this acquisition to improve the quality
and relevance of search on Etsy.com. Total consideration for the acquisition was approximately $15.0 million, consisting of
$8.1 million in cash and 513,304 shares of the Company’s common stock with a fair value of $6.9 million on the acquisition
date. Additionally, the Company issued 184,230 shares of restricted stock and restricted stock units (“RSUs”) on the acquisition
date with a fair value of $2.5 million which are tied to continuous service with the Company as an employee and are being
accounted for as post-combination stock-based compensation expense over up to a three-year vesting period. The Company
agreed to pay up to an additional $8.8 million in cash and issue an aggregate of up to 460,575 shares of RSUs post-close with a
fair value of $6.2 million, both of which are also tied to continuous service with the Company as an employee and are being
accounted for as post-combination stock-based and other compensation expense over up to a three-year vesting period. A
portion of the consideration and post-combination compensation is subject to indemnification provisions.
The below table summarizes the components of the Blackbird purchase price and allocation of the purchase price at fair value
(in thousands):
Cash paid
Common shares
Total purchase consideration
Net working capital
Developed technology
Customer relationships
Goodwill
Deferred tax liability
Net assets acquired
$
$
$
$
8,050
6,966
15,016
81
7,200
1,250
8,660
(2,175)
15,016
Included in working capital is approximately $0.2 million of cash acquired.
The amounts allocated to developed technology and customer relationships (the acquired intangible assets) total $8.5 million.
The acquired identifiable intangible assets are being amortized on a straight-line basis approximating the pattern in which the
assets are utilized. Acquired technology intangible assets will amortize over three years and acquired customer relationships
were amortized over six months from the acquisition date. The fair value assigned to developed technology was determined
primarily by using the cost approach, which estimates the cost to reproduce the asset, adjusted for loss due to functional and
economic obsolescence. The fair value of the Company’s customer relationships was determined primarily by using the income
approach, which discounts expected future cash flows to present value using estimates and assumptions determined by
management. Goodwill recorded in connection with the Blackbird acquisition is primarily attributed to the value of the acquired
workforce and their future contribution to Etsy. None of the resulting goodwill is deductible for tax purposes.
The Company incurred approximately $0.6 million in acquisition-related costs in the Blackbird acquisition in the year ended
December 31, 2016, included in general and administrative expenses. This acquisition contributed $2.4 million to the
Company’s consolidated net loss in the year ended December 31, 2016.
116
Etsy, Inc.
Notes to Consolidated Financial Statements
The following unaudited pro forma financial information presents the combined operating results of the Company and
Blackbird as if the acquisition had occurred on January 1, 2015. The unaudited pro forma financial information includes the
accounting effects of the business combination, including adjustments to the amortization of intangible assets, stock-based and
other compensation expenses, and professional fees associated with the acquisition. The unaudited pro forma information does
not necessarily reflect the actual results that would have been achieved, nor is it necessarily indicative of our future
consolidated results.
The unaudited pro forma financial information is presented in the table below for the year ended December 31, 2016 (in
thousands except per share amounts):
Revenue
Net loss
Basic and diluted net loss per share
Note 6—Goodwill and Intangible Assets
Year Ended
December 31,
2016
$
365,786
(35,401)
(0.31)
The following table summarizes the changes in the carrying amount of goodwill for the periods indicated (in thousands):
Balance as of the beginning of the period
Foreign currency translation adjustments
Balance as of the end of the period
Year Ended
December 31,
2018
2017
$
$
38,541
$
(1,059)
37,482
$
35,657
2,884
38,541
The Company did not recognize any goodwill impairments during the years ended December 31, 2018, 2017, and 2016.
At December 31, 2018 and 2017, the gross book value and accumulated amortization of intangible assets were as follows (in
thousands):
Technology
Referral agreement
Patent licenses
Intangible assets, net
As of December 31, 2018
As of December 31, 2017
Gross book
value
Accumulated
amortization
Net book
value
Gross book
value
Accumulated
amortization
Net book
value
$
$
7,200
$
(5,500) $
1,700
$
7,200
$
(3,100) $
4,100
34,595
172
(1,874)
(4)
32,721
168
—
—
—
—
—
—
41,967
$
(7,378) $
34,589
$
7,200
$
(3,100) $
4,100
On June 15, 2018, the Company entered into a referral agreement with DaWanda GmbH (“DaWanda”), a privately held
Germany-based marketplace for gifts and handmade items. As part of this agreement, DaWanda agreed to encourage its
community of buyers and sellers to migrate to the Etsy platform. DaWanda wound down its operations and shut down its site on
August 30, 2018. Etsy did not acquire any of DaWanda’s assets, liabilities, or employees as part of this agreement. The
Company accounted for the agreement as an asset acquisition and the referral agreement intangible asset will be amortized on a
straight-line basis over a period of 10 years.
The Company acquired intangible assets valued at $8.5 million in the Blackbird acquisition on September 19, 2016.
Amortization expense for the years ended December 31, 2018, 2017, and 2016 was $4.3 million, $3.4 million, and $3.3 million,
respectively.
The Company did not recognize any intangible asset impairment losses in the years ended December 31, 2018 and 2017. The
Company recognized a $0.6 million intangible asset impairment loss during the year ended December 31, 2016, included in
117
Etsy, Inc.
Notes to Consolidated Financial Statements
asset impairment charges. During the fourth quarter of 2016, the Company determined that there were indicators present that
the carrying amount of intangible assets acquired in the ALM and Jarvis Labs, Inc. (“Grand St.”) acquisitions may not be
recoverable. The Company prepared an undiscounted cash flow analysis and determined that intangible assets for customer
relationships and trademarks acquired in the ALM and Grand St. acquisitions were not recoverable. The Company used the
income approach to determine the fair value of intangible assets and concluded that these assets were fully impaired.
Based on amounts recorded at December 31, 2018, the Company estimates intangible asset amortization expense in each of the
years ending December 31 as follows (in thousands):
2019
2020
2021
2022
2023
Thereafter
Total amortization expense
$
$
5,178
3,477
3,477
3,477
3,477
15,503
34,589
Note 7—Segment and Geographic Information
The Company has determined it operates as one operating and reportable segment for purposes of allocating resources and
evaluating financial performance.
Revenue by country is based on the billing address of the seller. The following table summarizes revenue, income (loss) before
income taxes and net income (loss) by geographic area (in thousands):
United States
International
Revenue
United States (1)
International (2)
Income (loss) before income taxes
United States (3)
International (2)
Net income (loss)
Year Ended
December 31,
2018
2017
2016
425,841
$
317,755
$
276,537
177,852
123,476
88,430
603,693
$
441,231
$
364,967
10,778
$
(43,014) $
44,300
75,279
55,078
$
32,265
$
10,493
$
7,029
$
66,998
74,771
77,491
$
81,800
$
9,123
(11,999)
(2,876)
(17,345)
(12,556)
(29,901)
$
$
$
$
$
$
(1) The United States loss before income taxes in the year ended December 31, 2017 was primarily driven by a foreign
exchange loss, interest associated with the build-to-suit lease accounting related to our corporate headquarters,
restructuring and other exit costs, and asset impairment charges. See “Note 17—Restructuring and Other Exit Costs
(Income)” and “Note 6—Goodwill and Intangible Assets” for additional information on restructuring and other exit
costs and asset impairment charges.
(2) The international loss before income taxes and net loss in the year ended December 31, 2016 was primarily driven by a
foreign exchange loss related to the U.S. Dollar to Euro exchange rate fluctuations on the Company's intercompany
and other non-functional currency balances.
(3) The United States net loss in the year ended December 31, 2016 was primarily driven by an income tax provision
recorded in the period, mainly attributable to tax expense related to the updated corporate structure. See “Note 3—
Income Taxes” for additional information.
No individual international country’s revenue exceeded 10% of total revenue. All significant long-lived assets are located in the
United States.
118
Etsy, Inc.
Notes to Consolidated Financial Statements
Note 8—Fair Value Measurements
The Company has characterized its investments in marketable securities, based on the priority of the inputs used to value the
investments, into a three-level fair value hierarchy. The fair value hierarchy gives the highest priority to quoted prices in active
markets for identical assets or liabilities (Level 1), and lowest priority to unobservable inputs (Level 3). If the inputs used to
measure the investments fall within different levels of the hierarchy, the categorization is based on the lowest level input that is
significant to the fair value measurement of the investment. Investments recorded in the accompanying Consolidated Balance
Sheet are categorized based on the inputs to valuation techniques as follows:
Level 1—These are investments where values are based on unadjusted quoted prices for identical assets in an active
market that the Company has the ability to access.
Level 2—These are investments where values are based on quoted market prices in markets that are not active or model
derived valuations in which all significant inputs are observable in active markets.
Level 3—These are liabilities where values are derived from techniques in which one or more significant inputs are
unobservable.
The following are the major categories of assets and liabilities measured at fair value on a recurring basis as of the dates
indicated (in thousands):
Asset
Cash equivalents:
Commercial paper
Money market funds
Short-term investments:
Commercial paper
Corporate bonds
U.S. Government and agency securities
Funds receivable and seller accounts:
Money market funds
As of December 31, 2018
Level 1
Level 2
Level 3
Total
$
— $
7,775
$
— $
244,856
244,856
—
—
62,641
62,641
9,229
9,229
—
7,775
147,860
46,801
—
194,661
—
—
—
—
—
—
—
—
—
—
7,775
244,856
252,631
147,860
46,801
62,641
257,302
9,229
9,229
$
316,726
$
202,436
$
— $
519,162
119
Etsy, Inc.
Notes to Consolidated Financial Statements
Asset
Cash equivalents:
Commercial paper
Money market funds
U.S. Government and agency securities
Short-term investments:
Commercial paper
Corporate bonds
U.S. Government and agency securities
Funds receivable and seller accounts:
Money market funds
As of December 31, 2017
Level 1
Level 2
Level 3
Total
$
— $
11,290
$
— $
204,867
24,989
229,856
—
—
9,362
9,362
14,144
14,144
—
—
11,290
2,998
12,748
—
15,746
—
—
—
—
—
—
—
—
—
—
—
11,290
204,867
24,989
241,146
2,998
12,748
9,362
25,108
14,144
14,144
$
253,362
$
27,036
$
— $
280,398
Level 1 instruments include investments in debt securities including money market funds and U.S. Government and agency
securities, which are valued based on inputs including quotes from broker-dealers or recently executed transactions in the same
or similar securities.
Level 2 instruments include investments in debt securities, including fixed-income funds consisting of investments in
commercial paper and corporate bonds, which are valued based on quoted market prices in markets that are not active or model
derived valuations in which all significant inputs are observable in active markets.
Level 3 instruments historically included post-combination compensation classified as a liability in connection with the
acquisition of ALM. The post-combination compensation was classified as a liability due to its affiliation with a related put
option, which expired upon vesting of the underlying consideration in the second quarter of 2017, and its fair value was
previously determined based on the fair value of the Company’s common stock at the period-end reporting date, with
adjustments included in general and administrative expenses.
See “Note 9—Marketable Securities” for additional information on the Company’s marketable securities measured at fair value.
Disclosure of Fair Values
Our financial instruments that are not remeasured at fair value include the Notes (see “Note 13—Debt”). The Company
estimates the fair value of the Notes through consideration of quoted market prices of similar instruments, classified as Level 2
as described above. The estimated fair value of the Notes was $279.1 million as of December 31, 2018.
120
Etsy, Inc.
Notes to Consolidated Financial Statements
Note 9—Marketable Securities
Short-term investments and certain cash equivalents consist of investments in debt securities that are available-for-sale. The
cost and fair value of available-for-sale securities were as follows as of the dates indicated (in thousands):
Gross
Unrealized
Holding Loss
Gross
Unrealized
Holding Gain
Cost
Fair Value
December 31, 2018
Cash equivalents:
Commercial paper
Short-term investments:
Commercial paper
Corporate bonds
U.S. Government and agency securities
December 31, 2017
Cash equivalents:
Commercial paper
U.S. Government and agency securities
Short-term investments:
Commercial paper
Corporate bonds
U.S. Government and agency securities
$
$
$
7,775
$
7,775
147,860
46,836
62,638
257,334
— $
—
—
(35)
(9)
(44)
265,109
$
(44) $
— $
—
—
—
12
12
12
$
11,290
$
— $
— $
24,990
36,280
2,998
12,754
9,352
25,104
(1)
(1)
—
(6)
(1)
(7)
$
61,384
$
(8) $
—
—
—
—
11
11
11
$
7,775
7,775
147,860
46,801
62,641
257,302
265,077
11,290
24,989
36,279
2,998
12,748
9,362
25,108
61,387
The Company’s investments in marketable securities consist primarily of investments debt securities, including fixed-income
funds and U.S. Government and agency securities. When evaluating investments for other-than-temporary impairment, the
Company reviews factors such as length of time and extent to which fair value has been below cost basis, the financial
condition of the issuer and the Company’s ability, and intent to hold the investment for a period of time, which may be
sufficient for anticipated recovery in market value. The Company evaluates fair values for each individual security in the
investment portfolio.
See “Note 8—Fair Value Measurements” for additional information on the Company’s marketable securities measured at fair
value.
Note 10—Warrants
As of December 31, 2018, 2017, and 2016, the Company did not have any outstanding warrants.
In May 2016, the Company issued 80,011 shares of common stock upon the net exercise of warrants to purchase 97,931 shares
of common stock with a weighted-average exercise price of $1.62 per share and a weighted-average fair market value of
common stock at the date of exercise of $8.88. The warrant holders exercised this warrant in a cashless transaction and
17,920 shares were forfeited to the Company as payment of the exercise price.
The Company did not record any unrealized gains or losses from the remeasurement of the warrants to fair value in the years
ended December 31, 2018, 2017, and 2016.
121
Etsy, Inc.
Notes to Consolidated Financial Statements
Note 11—Property and Equipment
Property and equipment consisted of the following as of the dates indicated (in thousands):
Estimated useful lives
2018
2017
As of
December 31,
Computer equipment
Furniture and equipment
Software
Leasehold improvements
Construction in progress
Building
3 years
2 - 4 years
1 - 3 years
Shorter of life of asset or lease term
Not applicable
25 years
Website development and internal-use software
Shorter of life of asset or contract term
Less: Accumulated depreciation and amortization
$
36,670
$
6,574
—
10,731
551
81,892
69,201
205,619
85,440
$
120,179
$
35,587
6,194
908
10,929
—
81,892
48,333
183,843
66,226
117,617
Depreciation and amortization expense on property and equipment was $22.4 million, $23.8 million, and $19.2 million for the
years ended December 31, 2018, 2017, and 2016, respectively, which includes amortization expense for equipment acquired
under capital leases of $5.9 million, $7.7 million, and $6.3 million for the years ended December 31, 2018, 2017, and 2016,
respectively. The gross balance of leased equipment as of December 31, 2018 and 2017 was $29.7 million and $27.7 million,
respectively. The related accumulated amortization of equipment under capital leases was $24.4 million and $18.6 million at
December 31, 2018 and 2017, respectively.
The following table summarizes capitalized website development and internal-use software activities during the periods
indicated (in thousands):
Balance as of the beginning of the period
Additions to website development, excluding stock-based compensation
Additions to website development—stock-based compensation
Less: Retirements
Less: Impairments
Less:
Accumulated amortization balance as of the beginning of the period
Amortization Expense
Less: Retirements
Less: Impairments
Accumulated amortization balance as of the end of the period
Year Ended
December 31,
2018
2017
$
48,333
$
19,816
2,252
1,200
—
69,201
29,991
9,519
1,092
—
38,418
$
30,783
$
43,294
10,028
807
625
5,171
48,333
24,155
8,209
364
2,009
29,991
18,342
For the years ended December 31, 2018, 2017, and 2016, the Company recorded amortization expense relating to capitalized
website development and internal-use software of $9.5 million, $8.2 million, and $6.3 million, respectively. The loss on write-
off for capitalized website development and internal-use software assets that were retired during the years ended December 31,
2018, 2017, and 2016 was $0.1 million, $0.3 million, and $0.9 million, respectively.
The Company recognized a $3.2 million impairment loss related to capitalized website development and internal-use software
during the year ended December 31, 2017, included in asset impairment charges. During the fourth quarter of 2017, the
Company made the decision to discontinue certain product offerings, including Etsy Studio and Etsy Manufacturing, which was
122
Etsy, Inc.
Notes to Consolidated Financial Statements
an indicator that the carrying amount of certain capitalized website development and internal-use software assets may not be
recoverable. The Company prepared an undiscounted cash flow analysis and determined that the values for these assets
exceeded the expected future cash flows and impaired the remaining book values based on a negative present value of projected
undiscounted cash flows.
Note 12—Accrued Expenses
Accrued expenses consisted of the following as of the dates indicated (in thousands):
Vendor accruals
Accrued bonus
Sales and use tax payable
Accrued vacation
Payroll-related liabilities
Other
Total accrued expenses
Note 13—Debt
Convertible Debt
As of December 31,
2018
2017
17,817
$
14,576
12,906
12,232
3,787
2,406
10
4,364
3,682
3,136
2,920
65
49,158
$
28,743
$
$
In March 2018, the Company issued $345.0 million aggregate principal amount of 0% Convertible Senior Notes due 2023 (the
“Notes”) in a private placement to qualified institutional buyers pursuant to Rule 144A under the Securities Act of 1933, as
amended (the “Securities Act”). The net proceeds from the sale of the Notes were $335.0 million after deducting the initial
purchasers’ discount and offering expenses.
The Notes are convertible based upon an initial conversion rate of 27.5691 shares of the Company’s common stock
per $1,000 principal amount of Notes (equivalent to an initial conversion price of approximately $36.27 per share). The
conversion rate will be subject to adjustment upon the occurrence of certain specified events, including certain distributions and
dividends to all or substantially all of the holders of the Company’s common stock. The Company will settle any conversions of
the Notes in cash, shares of the Company’s common stock, or a combination thereof, with the form of consideration determined
at the Company’s election.
The Notes will mature on March 1, 2023, unless earlier converted or repurchased. Prior to the close of business on the business
day immediately preceding November 1, 2022, holders may convert all or a portion of their Notes only under the following
circumstances: (1) during any calendar quarter commencing after the calendar quarter ending on June 30, 2018 (and only during
such calendar quarter), if the last reported sale price of the Company’s common stock for at least 20 trading days (whether or
not consecutive) during a period of 30 consecutive trading days ending on, and including, the last trading day of the
immediately preceding calendar quarter is greater than or equal to 130% of the conversion price on each applicable trading day;
(2) during the 5 business day period after any 10 consecutive trading day period (the “measurement period”) in which the
trading price per $1,000 principal amount of Notes for each trading day of the measurement period was less than 98% of the
product of the last reported sale price of the Company’s common stock and the conversion rate on each such trading day;
(3) with respect to any or all of the Notes called for redemption by the Company prior to the close of business on the business
day immediately preceding November 1, 2022, holders may convert all or any portion of their Notes at any time prior to the
close of business on the second scheduled trading day prior to the redemption date, even if the Notes are not otherwise
convertible at such time; (4) upon the occurrence of specified corporate events. On and after November 1, 2022 until the close
of business on the second scheduled trading day immediately preceding the maturity date, holders may convert their Notes at
any time, regardless of the foregoing circumstances.
If a fundamental change occurs prior to the maturity date, holders may require the Company to repurchase all or a portion of
their Notes for cash at a price equal to 100% of the principal amount of the Notes to be repurchased. Holders of Notes who
convert their Notes in connection with a notice of a redemption or a make-whole fundamental change may be entitled to a
123
Etsy, Inc.
Notes to Consolidated Financial Statements
premium in the form of an increase in the conversion rate of the Notes. During the fourth quarter of 2018, the closing price of
the Company’s common stock exceeded 130% of the applicable conversion price of the Notes on at least 20 of the last 30
consecutive trading days of the quarter; therefore, holders of the Notes may convert their Notes during the first quarter of 2019.
As of December 31, 2018, the Company had not received any conversion notices, and, as such, the Notes are not currently
redeemable for cash and are therefore classified as long-term debt. As of December 31, 2018, the if-converted value of the
Notes was approximately $107.5 million higher than the aggregate principal amount, or $452.5 million, offset in entirety by the
capped call transactions described below.
The Notes are general unsecured obligations of the Company. The Notes rank senior in right of payment to all of the
Company’s future indebtedness that is expressly subordinated in right of payment to the Notes; rank equal in right of payment
with all of our liabilities that are not so subordinated; are effectively junior to any of the Company’s secured indebtedness; and
are structurally junior to all indebtedness and liabilities (including trade payables) of the Company’s subsidiaries.
In accounting for the issuance of the Notes, the Company separated the Notes into liability and equity components. The
carrying amount of the liability component was calculated by measuring the fair value of a similar liability that does not have
an associated convertible feature. The carrying amount of the equity component, representing the conversion option, which
does not meet the criteria for separate accounting as a derivative as it is indexed to the Company’s own stock, was determined
by deducting the fair value of the liability component from the par value of the Notes. The difference between the principal
amount of the Notes and the liability component represents the debt discount, which is recorded as a direct deduction from the
related debt liability in the Consolidated Balance Sheet and accreted over the period from the date of issuance to the contractual
maturity date, resulting in the recognition of non-cash interest expense. The equity component of the Notes of
approximately $72.8 million is included in additional paid-in capital in the Consolidated Balance Sheet and is not remeasured
as long as it continues to meet the conditions for equity classification. Transaction costs were allocated to the liability and
equity components in the same proportion as the allocation of the proceeds. Transaction costs attributable to the liability
component were recorded as a direct deduction from the related debt liability in the Consolidated Balance Sheet and are
amortized to interest expense using the effective interest method over the term of the Notes, and transaction costs attributable to
the equity component were netted with the equity component in stockholders’ equity.
Non-cash interest expense related to the Notes for the year ended December 31, 2018 was $12.2 million. Total unamortized
debt issuance costs were $6.7 million as of December 31, 2018.
The estimated fair value of the Notes was $279.1 million as of December 31, 2018. The estimated fair value of the Notes was
determined through consideration of quoted market prices for similar instruments. The fair value is classified as Level 2, as
defined in “Note 8—Fair Value Measurements.”
Capped Call Transactions
The Company used $34.2 million of the net proceeds from the Notes offering to enter into separate capped call transactions
(“Capped Call Transactions”) with the initial purchasers and/or their respective affiliates. The Capped Call Transactions are
expected generally to reduce the potential dilution and/or offset the cash payments the Company is required to make in excess
of the principal amount of the Notes upon conversion of the Notes in the event that the market price per share of the Company’s
common stock is greater than the strike price of the Capped Call Transactions with such reduction and/or offset subject to a cap.
The Capped Call Transactions have an initial cap price of $52.76 per share of the Company’s common stock, which represents a
premium of 100% over the last reported sale price of the Company’s common stock on March 8, 2018, and is subject to certain
adjustments under the terms of the Capped Call Transactions. Collectively, the Capped Call Transactions cover, initially, the
number of shares of the Company’s common stock underlying the Notes, subject to anti-dilution adjustments substantially
similar to those applicable to the Notes.
The Capped Call Transactions do not meet the criteria for separate accounting as a derivative as they are indexed to the
Company’s stock. The premiums paid for the Capped Call Transactions have been included as a net reduction to
additional paid-in capital within stockholders’ equity.
124
Etsy, Inc.
Notes to Consolidated Financial Statements
Credit Agreement
The Company terminated the senior secured revolving credit facility pursuant to a Revolving Credit and Guaranty Agreement
with several lenders (the “2014 Credit Agreement”) effective as of November 21, 2017. As of the date of termination, there
were no borrowings outstanding under the 2014 Credit Agreement and we incurred no additional fees as a result of early
termination. In May 2014, the Company entered into a $35.0 million Credit Agreement. In March 2015, the Company amended
the 2014 Credit Agreement to increase the credit facility to $50.0 million. In December 2015, the Company amended the 2014
Credit Agreement to clarify certain provisions relating to permitted investments and to make other immaterial updates. The
amended 2014 Credit Agreement included a letter of credit sublimit of $10.0 million and a swingline loan sublimit of $15.0
million. The 2014 Credit Agreement, as amended, would have expired in May 2019.
Subsequent Event
On February 25, 2019, the Company entered into a $200.0 million senior secured revolving credit facility pursuant to a Credit
Agreement (the “2019 Credit Agreement”) with lenders party thereto from time to time, and Citibank N.A., as administrative
Agent. The 2019 Credit Agreement will mature in February 2024. The 2019 Credit Agreement includes a letter of credit
sublimit of $30.0 million and a swingline loan sublimit of $10.0 million.
Borrowings under the 2019 Credit Agreement (other than swingline loans) bear interest, at the Company’s option, at (i) a base
rate equal to the highest of (a) the prime rate, (b) the federal funds rate plus 0.50%, and (c) an adjusted LIBOR rate for a one-
month interest period plus 1.00%, in each case plus a margin ranging from 0.25% to 0.875% or (ii) an adjusted LIBOR rate plus
a margin ranging from 1.25% to 1.875%. Swingline loans under the 2019 Credit Agreement bear interest at the same base rate
(plus the margin applicable to borrowings bearing interest at the base rate). These margins are determined based on the senior
secured net leverage ratio (defined as secured funded debt, net of unrestricted cash up to $100 million, to EBITDA) for the
preceding four fiscal quarter period. The Company is also obligated to pay other customary fees for a credit facility of this size
and type, including an unused commitment fee, ranging from 0.20% to 0.35% depending on the Company’s senior secured net
leverage ratio, and fees associated with letters of credit. The 2019 Credit Agreement also permits the Company, in certain
circumstances, to request an increase in the facility by an amount of up to $100.0 million at the same maturity, pricing and other
terms and to request an extension of the maturity date for the facility. In connection with the 2019 Credit Agreement, the
Company also paid the lenders certain upfront fees.
The 2019 Credit Agreement contains customary representations and warranties applicable to the Company and its subsidiaries
and customary affirmative and negative covenants applicable to the Company and its restricted subsidiaries. The negative
covenants include restrictions on, among other things, indebtedness, liens, certain fundamental changes (including mergers),
investments, dispositions, restricted payments (including dividends and stock repurchases), prepayments of junior debt, and
transactions with affiliates. These restrictions do not prohibit a subsidiary of the Company from making pro rata payments to
the Company or any other person that owns an equity interest in such subsidiary. The 2019 Credit Agreement contains financial
covenants, that require the Company and its subsidiaries to maintain (i) a secured net leverage ratio not to exceed 3.00 to 1.00,
subject to an increase, at the option of the Company, to 3.50 to 1.00 for a specified period of time in the event of certain
material acquisitions, tested as of the last day of each fiscal quarter and (ii) an interest coverage ratio (defined as the ratio of
EBITDA to cash interest expense) of not less than 2.50 to 1.00, tested for each fiscal quarter.
The 2019 Credit Agreement includes customary events of default, including, but not limited to, nonpayment of principal or
interest, breaches of representations and warranties, failure to perform or observe covenants, cross-defaults with certain other
indebtedness, final judgments or orders, certain change of control events, and certain bankruptcy-related events or proceedings.
Upon the occurrence of an event of default (subject to notice and grace periods), obligations under the 2019 Credit Agreement
could be accelerated.
Subject to certain exceptions, to the extent the Company has any material domestic subsidiaries, the obligations under the 2019
Credit Agreement would be required to be guaranteed by such material domestic subsidiaries. The obligations under the 2019
Credit Agreement are secured by all or substantially all of the assets of the Company and any such subsidiary guarantors.
At February 28, 2018, the Company did not have any borrowings under the 2019 Credit Agreement.
125
Etsy, Inc.
Notes to Consolidated Financial Statements
Note 14—Commitments and Contingencies
Lease Commitments
Capital Leases
The Company entered into a credit agreement with Dell Financial Services, LLC. (“DFS”) on February 17, 2016, which
provided the Company with a credit line of up to $6.0 million for hosting equipment leases (the “DFS Line”), which was
increased to $9.0 million during 2017. This credit line expired in December 2018. The DFS Line allowed the Company to lease
hosting equipment from DFS. The leases have a 36-month term, zero interest and are payable in equal monthly installments
with a buy-out option of $1 at the end of the lease term. As of December 31, 2018, the Company has lease obligations of
approximately $2.9 million related to leased hosting equipment using the previously active DFS Line.
The Company entered into a credit agreement with ePlus Group, Inc. (“ePlus”) on January 3, 2014, which provided the
Company with a credit line of up to $8.0 million for computer equipment leases (the “ePlus Line”), which was increased to
$18.0 million during 2015. The ePlus Line allows the Company to order equipment from any approved vendor. ePlus purchases
the equipment on behalf of the Company and leases it back to the Company. The leases have a 36-month term, interest rate of
3.71-6.93% and are payable in equal monthly installments with a fair market value or a $1 buy-out option at the end of the lease
term depending on the equipment. As of December 31, 2018, the Company has lease obligations of approximately $3.1 million
related to leased computer equipment using the ePlus Line.
For the years ended December 31, 2018, 2017, and 2016, the accompanying Consolidated Statement of Operations includes
charges of approximately $1.0 million, $1.6 million, and $1.6 million for interest expense, respectively, related to the equipment
leased using the DFS and ePlus Lines.
Operating Leases
The Company did not enter into any material operating leases or extensions in 2018, 2017, or 2016. Rent expense for the
Company’s operating leases is recognized over the term of each respective lease on a straight-line basis. In addition, the
Company leases other office facilities under shorter terms and cancelable leases.
Total rent expense for the years ended December 31, 2018, 2017, and 2016 was $3.8 million, $4.1 million, and $6.0 million,
respectively.
Build-to-Suit Lease
In May 2014, the Company entered into a 10-year lease agreement for approximately 199,000 rentable square feet of office
space in Brooklyn, New York for the Company’s headquarters, which commenced in 2015. Of the total office space,
approximately 172,000 rentable square feet is being accounted for as a build-to-suit lease and approximately 27,000 rentable
square feet located in an adjacent building is being accounted for as an operating lease. In connection with the lease agreement,
the Company established a $5.3 million collateral account, reflected in the restricted cash balance on the Consolidated Balance
Sheet.
Purchase Obligations
The Company has $61.1 million of non-cancelable contractual commitments as of December 31, 2018, primarily related to the
initiative to migrate its data centers to the cloud, as well as other support services. These commitments are primarily due
within four years.
126
Etsy, Inc.
Notes to Consolidated Financial Statements
The following table represents the Company’s commitments under its current capital, operating and build-to-suit lease
agreements and purchase obligations as of December 31, 2018 (in thousands):
Periods ending
2019
2020
2021
2022
2023
Thereafter
Total minimum payments required
Amounts representing interest
Present value of net minimum payments
Current maturities
Long-term payment obligations
Long-Term Debt
Capital Lease
Obligations
Operating
Leases
Build-to-Suit
Lease
Purchase
Obligations
$
4,392
$
4,904
$
9,451
$
1,754
481
—
—
—
4,783
4,185
4,180
4,205
9,760
9,522
10,354
10,520
10,599
27,715
10,696
17,374
16,000
17,000
—
—
$
$
6,627
$
32,017
$
78,161
$
61,070
648
5,979
3,884
2,095
In March 2018, the Company issued $345.0 million aggregate principal amount of 0% Convertible Senior Notes due 2023 (the
“Notes”) in a private placement to qualified institutional buyers pursuant to Rule 144A under the Securities Act. The Notes will
mature on March 1, 2023, unless earlier converted or repurchased, and there are no contractual payments required until
maturity. For more information on the Notes, see “Note 13—Debt.”
Non-Income Tax Contingencies
The Company had reserves of $0.9 million and $0.4 million at December 31, 2018 and 2017, respectively, for certain non-
income tax obligations, representing management’s best estimate of its potential liability. The Company could also be subject to
examination in various jurisdictions related to income tax and non-income tax matters. The resolution of these types of matters,
if in excess of the recorded reserve, could have an adverse impact on the Company’s business.
Legal Proceedings
Cervantes and Weiss Cases
On July 21, 2015, a purported securities class action complaint (Cervantes v. Dickerson, et.al., Case No. CIV 534768) was filed
in the Superior Court of State of California, County of San Mateo against the Company, certain officers, directors, and
underwriters. The complaint asserted violations of Sections 11 and 15 of the Securities Act. The complaint alleged
misrepresentations in the Company’s Registration Statement on Form S-1 and Prospectus with respect to, among other things,
merchandise for sale on the Company’s website that may be counterfeit or constitute trademark or copyright infringement. The
complaint sought certification as a class action and unspecified compensatory damages plus interest and attorneys’ fees. On
December 7, 2015, the Company and the underwriter defendants moved to stay the Cervantes action on the grounds of forum
non conveniens.
On November 5, 2015, another purported securities class action complaint (Weiss v. Etsy et al., No. CIV 536123) was filed in
the Superior Court of State of California, County of San Mateo. The Weiss complaint named as defendants the Company and
the same officers, directors, and underwriters named in the Cervantes complaint, and also asserts violations of Sections 11 and
15 of the Securities Act based on allegedly false or misleading statements or omissions with respect to, among other things,
merchandise for sale on the Company’s website that may be counterfeit or constitute trademark or copyright infringement. On
December 24, 2015, the court consolidated the Cervantes and Weiss actions. On February 3, 2016, the court granted the
Company’s motion to stay the consolidated actions. On September 19, 2018, the court granted plaintiffs’ request to dismiss the
consolidated Cervantes and Weiss actions with prejudice.
127
Etsy, Inc.
Notes to Consolidated Financial Statements
In addition, from time to time in the normal course of business, various other claims and litigation have been asserted or
commenced against the Company. Due to uncertainties inherent in litigation and other claims, the Company can give no
assurance that it will prevail in any such matters, which could subject the Company to significant liability for damages. Any
claims or litigation, regardless of their success, could have an adverse effect on the Company’s Consolidated Results of
Operations or Cash Flows in the period the claims or litigation are resolved. Although the results of litigation and claims cannot
be predicted with certainty, we currently believe that the final outcome of these ordinary course matters will not have a material
adverse effect on our business.
Note 15—Stockholders’ Equity
At December 31, 2018 and 2017, the authorized capital stock of the Company included 1,400,000,000 shares of common stock.
At December 31, 2018 and 2017 there were 25,000,000 shares of preferred stock authorized.
Common Stock
At December 31, 2018 and 2017 there were 119,771,702 and 121,769,238 shares of common stock issued and outstanding,
respectively. Holders of common stock are entitled to one vote per share. Holders of common stock are not entitled to receive
dividends unless declared by the Board of Directors. No dividends have been declared through December 31, 2018. The
common stock has a $0.001 par value.
Convertible Preferred Stock
Upon the closing of the IPO on April 21, 2015, all outstanding shares of convertible preferred stock were converted into
53,448,243 shares of common stock. As of December 31, 2018, 2017, and 2016, there was no convertible preferred stock
outstanding.
Common Stock Issuances
In the year ended December 31, 2016, the Company issued a total of 685,749 shares of common stock in connection with the
acquisition of Blackbird, of which 513,304 shares with an aggregate fair value of $6.9 million on the applicable acquisition date
is included in the purchase price and 172,445 shares with an aggregate fair value of $2.3 million on the applicable acquisition
date is tied to continued employment with the Company and is being accounted for as post-combination compensation expense.
Share Repurchase Program
On November 1, 2018, the Board of Directors approved a stock repurchase program that enables the Company to repurchase up
to $200 million of its common stock. The program does not have a time limit and may be modified, suspended, or terminated at
any time by the Board of Directors. The number of shares repurchased and the timing of repurchases will depend on a number
of factors, including, but not limited to, stock price, trading volume and general market conditions, along with Etsy’s working
capital requirements, general business conditions and other factors.
In November 2017, the Board of Directors approved a stock repurchase program that enabled the Company to repurchase up to
$100 million of its common stock. The program was completed in the second quarter of 2018.
Under the stock repurchase program, the Company may purchase shares of its common stock through various means, including
open market transactions, privately negotiated transactions, tender offers or any combination thereof. In addition, open market
repurchases of common stock may be made pursuant to trading plans established pursuant to Rule 10b5-1 under the Securities
Exchange Act of 1934, as amended, which would permit common stock to be repurchased at a time that the Company might
otherwise be precluded from doing so under insider trading laws or self-imposed trading restrictions.
128
Etsy, Inc.
Notes to Consolidated Financial Statements
The following table summarizes the Company’s share repurchase activity, excluding shares withheld to satisfy tax withholding
obligations in connection with the vesting of employee restricted stock units (in thousands except share and per share amounts):
New Authorization on November 17, 2017 of $100 million
— $
— $
— $
100,000
Shares
Repurchased
Average Price
Paid per Share
(1)
Value of
Shares
Repurchased
Remaining
Amount
Authorized
Repurchases of common stock for the three months ended:
December 31, 2017
Balance as of December 31, 2017
Repurchases of common stock for the three months ended:
March 31, 2018
June 30, 2018
September 30, 2018
New Authorization on November 1, 2018 of $200 million
Repurchases of common stock for the three months ended:
586,231
17.57
10,301
586,231
$
17.57
$
10,301
$
2,807,393
722,941
—
—
24.43
29.15
—
—
68,586
21,113
—
—
December 31, 2018
Balance as of December 31, 2018
916,083
49.11
45,000
5,032,648
$
28.80
$
145,000
$
(10,301)
89,699
(68,586)
(21,113)
—
200,000
(45,000)
155,000
(1) Average price paid per share excludes broker commissions.
All repurchases were made using cash resources.
Note 16—Stock-based Compensation
The Company’s 2015 Equity Incentive Plan (the “2015 Plan”) was adopted by its Board of Directors and approved by
stockholders in March 2015. The 2015 Plan became effective immediately upon adoption although no awards were made under
it until the effective date of the IPO. The 2015 Plan replaced the 2006 Stock Plan, and no further grants were made under the
2006 Stock Plan as of the effective date of the IPO.
Under the 2006 Stock Plan, incentive and nonqualified stock options or rights to purchase common stock were granted to
eligible participants. Options were generally granted for a term of 10 years and generally vested 25% after the first year of
service and ratably each month over the remaining 36-month period contingent on continued employment with the Company on
each vesting date.
The 2015 Plan provides for the grant of incentive stock options, non-statutory stock options, stock appreciation rights, restricted
stock, restricted stock units (“RSUs”), and performance cash awards to employees, directors, and consultants. Beginning in
2016, the number of shares available for issuance under the 2015 Plan may be increased annually by an amount equal to the
lesser of 7,050,000 shares of common stock, 5% of the outstanding shares of common stock as of the last day of the
immediately preceding fiscal year, or such other amount as determined by the Company’s Board of Directors. The Board of
Directors approved an increase of 2,395,434, 6,088,461, and 5,798,651 shares available for issuance under the 2015 Plan as of
January 2, 2019, January 2, 2018, and January 3, 2017, respectively. Any awards issued under the 2015 Plan that are forfeited
by the participant will become available for future grant under the 2015 Plan. The number of shares of the Company’s common
stock initially reserved for issuance under the 2015 Plan equaled the sum of 14,100,000 shares plus up to 12,653,075 shares
reserved for issuance or subject to outstanding awards under the 2006 Stock Plan. At December 31, 2018, 29,436,374 shares
were authorized under the 2015 Plan and 18,645,783 shares were available for future grant.
In the first quarter of 2017, the Company made an accounting policy election to recognize forfeitures as they occur upon
adoption of guidance in ASU 2016-09—Stock Compensation: Improvements to Employee Share-based Payment Accounting. In
reporting periods prior to 2017, the Company estimated forfeitures at the time of grant and revised in subsequent periods as
necessary if actual forfeitures differed from estimates.
In the year ended December 31, 2018, the Company granted nonqualified stock options and RSUs to eligible participants.
Options were generally granted for a term of 10 years. For both options and RSUs, vesting is typically over a four-year period
129
Etsy, Inc.
Notes to Consolidated Financial Statements
and is contingent upon continued employment with the Company on each vesting date. In general, options granted to newly-
hired employees prior to July 2018 vest 25% after the first year of service and ratably each month over the remaining 36-month
period. In general, RSUs granted to newly-hired employees prior to July 2018 vest 25% after the first year following the vesting
commencement date, which is the first day of the fiscal quarter closest to the date of grant, and then vest ratably each quarter
over the remaining 12-quarter period. In general, for current employees who received an additional grant prior to March 2018,
options vest ratably each month over a 48-month period. In general, for current employees who received an additional grant
prior to March 2018, RSUs vest ratably each quarter over a 16-quarter period following the vesting commencement date, which
is the first day of the fiscal quarter closest to the date of grant.
Beginning in July 2018, in general, for newly-hired employees, both options and RSUs vest 25% after the first year of service
and ratably each six-month period over a four-year period following the vesting commencement date, which is the first day of
the month closest to the date of grant. Beginning in March 2018, in general, for current employees who receive an additional
grant, both options and RSUs vest ratably each six-month period over a four-year period following the vesting commencement
date.
The fair value of each option award is estimated on the date of grant using the Black-Scholes option-pricing model using the
inputs below. Prior to the IPO, the Company utilized equity valuations based on comparable publicly-traded companies,
discounted free cash flows, an analysis of the Company’s enterprise value, and other factors deemed relevant in estimating the
fair value of its common stock. Subsequent to the IPO, the Company has used the closing price of its common stock on Nasdaq
as the fair value of its common stock. The risk-free rate for periods within the contractual life of the option is based on the U.S.
Treasury yield curve in effect at the time of grant for time periods that approximate the expected life of the option awards.
Expected volatilities are based on implied volatilities from Etsy and market comparisons of certain publicly traded companies
and other factors. The expected term of stock options granted has been determined using the simplified method, which uses the
midpoint between the vesting date and the contractual term. The requisite service period is generally four years from the date of
grant. The fair value of RSUs is determined based on the closing price of the Company’s common stock on Nasdaq on the grant
date.
The fair value of options granted in each year using the Black-Scholes pricing model has been based on the following
assumptions:
Volatility
Risk-free interest rate
Expected term (in years)
Dividend rate
Year Ended
December 31,
2018
2017
2016
38.6% - 47.8% 41.7% - 44.2% 38.6% - 44.6%
2.6% - 2.9%
1.9% - 2.2%
1.1% - 2.1%
5.5 - 6.3
—%
5.5 - 6.3
—%
5.5 - 6.3
—%
130
Etsy, Inc.
Notes to Consolidated Financial Statements
The following table summarizes the activity for the Company’s options (in thousands except share and per share amounts):
Shares
Weighted-Average
Exercise Price
Weighted-Average
Remaining Contract
Term (in years)
Aggregate
Intrinsic Value
Outstanding at December 31, 2015
11,068,859
$
Granted
Exercised
Forfeited/Canceled
Outstanding at December 31, 2016
Granted
Exercised
Forfeited/Canceled
Outstanding at December 31, 2017
Granted
Exercised
Forfeited/Canceled
Outstanding at December 31, 2018
Total exercisable at December 31, 2018
1,700,234
(2,535,620)
(893,906)
9,339,567
5,887,183
(5,760,263)
(1,518,548)
7,947,939
797,201
(1,588,779)
(265,367)
6,890,994
3,032,251
6.94
9.35
4.17
9.51
7.89
11.04
5.87
11.36
11.02
29.87
11.49
15.68
12.91
10.94
7.01
$
31,932
6.64
43,613
7.93
74,996
7.94
7.28
239,177
111,071
The following table summarizes the weighted-average grant date fair value of options granted, intrinsic value of options
exercised and fair value of awards vested in periods indicated (in thousands except per share amounts):
Year Ended December 31,
2018
2017
2016
Weighted average grant date fair value of options granted
$
13.33
$
4.85
$
Intrinsic value of options exercised
Fair value of awards vested
34,268
32,717
52,693
19,826
4.03
19,130
9,533
The total unrecognized compensation expense at December 31, 2018 was $22.9 million, which will be recognized over a
weighted-average period of 2.59 years.
The following table summarizes the activity for the Company’s unvested RSUs:
Unvested at December 31, 2015
Granted
Vested
Forfeited/Canceled
Unvested at December 31, 2016
Granted
Vested
Forfeited/Canceled
Unvested at December 31, 2017
Granted
Vested
Forfeited/Canceled
Unvested at December 31, 2018
Shares
Weighted-Average
Fair Value
395,846
$
3,200,297
(255,868)
(205,094)
3,135,181
2,360,315
(1,072,321)
(1,348,928)
3,074,247
2,448,169
(1,496,906)
(545,142)
3,480,368
13.70
10.29
10.64
10.15
10.70
12.17
10.44
10.56
11.98
28.22
13.80
18.47
22.87
The total unrecognized compensation at December 31, 2018 was $70.5 million, which will be recognized over a weighted-
average period of 3.03 years.
131
Etsy, Inc.
Notes to Consolidated Financial Statements
Total stock-based compensation expense included in the Consolidated Statements of Operations is as follows (in thousands):
Cost of revenue
Marketing
Product development
General and administrative
Total stock-based compensation expense
Year Ended
December 31,
2018
2017
2016
$
$
3,357
$
1,739
$
2,507
21,234
11,133
1,933
8,274
14,613
1,057
971
5,079
8,794
38,231
$
26,559
$
15,901
The total stock-based compensation expense in the years ended December 31, 2018, 2017, and 2016 includes $3.8 million, $3.9
million, and $2.7 million, in acquisition-related stock-based compensation expense, respectively.
During the year ended December 31, 2018, the Company incurred non-cash stock-based compensation expense of $7.0 million
resulting from the modification of stock options and RSUs to accelerate vesting of certain stock-based compensation in
connection with the departure of two employees. See “Note 17—Restructuring and Other Exit Costs (Income)” for information
on stock modifications incurred in 2017 related to restructuring.
Note 17—Restructuring and Other Exit Costs (Income)
On April 30, 2017, the Board of Directors approved a plan to increase efficiency and streamline the Company’s cost structure
through headcount reductions and a reduction in internal program expenses (the “May Actions”). On June 16, 2017, the Board
of Directors approved additional initiatives designed to improve focus on key strategic growth opportunities (together with the
May Actions, the “Actions”). The Actions included total headcount reductions of 245 positions or 23% of the total workforce as
of December 31, 2016, closing ALM, a marketplace in France, and closing or consolidating certain international offices.
In connection with the Actions, the Company incurred $13.9 million of restructuring and other exit costs in the year ended
December 31, 2017, comprised of employee severance, stock compensation modifications, and other exit costs, largely made up
of cash expenditures. The Company generated $0.2 million of income in the year ended December 31, 2018 due to changes in
estimated severance costs.
132
Etsy, Inc.
Notes to Consolidated Financial Statements
The following table displays restructuring and other exit costs (income) recorded related to the Actions and a rollforward of the
charges to the accrued expenses balance as of December 31, 2018 (in thousands):
Balance, December 31, 2016
$
— $
— $
— $
Severance
Charge
Stock-Based
Compensation
Other Exit Costs
Total
Total restructuring and other exit costs
Costs charged against equity/assets
Cash payments
Balance, June 30, 2017
Total restructuring and other exit costs
Costs charged against equity/assets
Cash payments
Balance, September 30, 2017
Total restructuring and other exit costs
Costs charged against equity/assets
Cash payments
Balance, December 31, 2017
Total restructuring and other exit costs (income)
Cash payments
Balance, March 31, 2018
Total restructuring and other exit costs (income)
Cash payments
Balance, June 30, 2018
Total restructuring and other exit costs (income)
Cash payments
Balance, September 30, 2018
Balance, December 31, 2018
8,972
—
(2,110)
6,862
871
—
(4,385)
3,348
361
—
(2,401)
1,308
(156)
(793)
359
(43)
(271)
45
(45)
—
—
1,668
(1,668)
—
—
965
(965)
—
—
68
(68)
—
—
—
—
—
—
—
—
—
—
—
620
—
(278)
342
(70)
—
(180)
92
442
(286)
(214)
34
5
—
39
2
(16)
25
(12)
(13)
—
$
— $
— $
— $
—
11,260
(1,668)
(2,388)
7,204
1,766
(965)
(4,565)
3,440
871
(354)
(2,615)
1,342
(151)
(793)
398
(41)
(287)
70
(57)
(13)
—
—
Total restructuring and other exit costs (income) included in the Consolidated Statements of Operations are as follows (in
thousands):
Cost of revenue
Marketing
Product development
General and administrative
Total restructuring and other exit costs (income)
Year Ended
December 31,
2018
2017
2016
(19) $
738
$
(82)
(110)
(38)
2,950
3,232
6,977
(249) $
13,897
$
—
—
—
—
—
$
$
133
Item 9. Changes in and Disagreements With Accountants on Accounting and Financial Disclosure.
None.
Item 9A. Controls and Procedures.
Evaluation of Disclosure Controls and Procedures
Our management, with the participation of our Chief Executive Officer and our Chief Financial Officer, evaluated the
effectiveness of our disclosure controls and procedures as of December 31, 2018. “Disclosure controls and procedures,” as
defined in Rules 13a-15(e) and 15d-15(e) under the Exchange Act, are designed to ensure that information required to be
disclosed by a company in the reports that it files or submits under the Exchange Act is (i) recorded, processed, summarized,
and reported within the time periods specified in the Securities and Exchange Commission’s rules and forms and (ii)
accumulated and communicated to the company’s management, including its principal executive officer and principal financial
officer, as appropriate to allow timely decisions regarding required disclosure. Based on the evaluation of our disclosure
controls and procedures, our Chief Executive Officer and Chief Financial Officer concluded that our disclosure controls and
procedures were effective as of December 31, 2018 at the reasonable assurance level.
Management’s Report on Internal Controls Over Financial Reporting
Our management is responsible for establishing and maintaining adequate internal control over financial reporting, as defined
in Rule 13a-15(f) and 15d-15(f) under the Exchange Act. Our management conducted an assessment of the effectiveness of our
internal control over financial reporting as of December 31, 2018 based on the criteria set forth in Internal Control-Integrated
Framework (2013) issued by the Committee of Sponsoring Organizations of the Treadway Commission. Based on the
assessment, our management has concluded that its internal control over financial reporting was effective as of December 31,
2018 to provide reasonable assurance regarding the reliability of financial reporting and the preparation of financial statements
in accordance with GAAP.
Our independent registered public accounting firm, PricewaterhouseCoopers LLP, has issued an audit report with respect to the
effectiveness of our internal control over financial reporting as of December 31, 2018, which appears in Part II, Item 8 of this
Annual Report on Form 10-K.
Changes in Internal Control over Financial Reporting
There were no changes in our internal control over financial reporting identified during the fourth quarter ended December,
31, 2018 that materially affected, or are reasonably likely to materially affect, our internal control over financial reporting.
Limitations on Controls
Our disclosure controls and procedures and internal control over financial reporting are designed to provide reasonable
assurance of achieving the desired control objectives. Our management recognizes that any control system, no matter how well
designed and operated, is based upon certain judgments and assumptions and cannot provide absolute assurance that its
objectives will be met. Similarly, an evaluation of controls cannot provide absolute assurance that misstatements due to error or
fraud will not occur or that all control issues and instances of fraud, if any, have been detected.
Item 9B. Other Information.
None.
134
Item 10. Directors, Executive Officers and Corporate Governance.
PART III.
The information required by this item is incorporated by reference to our Proxy Statement for the 2019 Annual Meeting of
Stockholders (“Proxy Statement”) to be filed with the SEC within 120 days of the fiscal year ended December 31, 2018.
Our Board of Directors has adopted a Code of Conduct applicable to all officers, directors, and employees, which is available
on our website (investors.etsy.com) under “Governance—Governance Documents.” We intend to satisfy the disclosure
requirement under Item 5.05 of Form 8-K regarding amendments and waivers of our Code of Conduct by posting information
on the website address specified above.
Item 11. Executive Compensation.
The information required by this item is incorporated by reference to our Proxy Statement.
Item 12. Security Ownership of Certain Beneficial Owners and Management and Related Stockholder Matters.
The information required by this item is incorporated by reference to our Proxy Statement.
Item 13. Certain Relationships and Related Transactions, and Director Independence.
The information required by this item is incorporated by reference to our Proxy Statement.
Item 14. Principal Accounting Fees and Services.
The information required by this item is incorporated by reference to our Proxy Statement.
135
PART IV.
Item 15. Exhibits, Financial Statement Schedules.
(a) The following documents are filed as part of this report:
(1) Financial Statements.
Our Consolidated Financial Statements are listed in the “Index to Consolidated Financial Statements” under Part II, Item 8
of this Annual Report on Form 10-K.
(2) Financial Statement Schedules.
All schedules are omitted because they are not applicable or because the required information is shown in the Consolidated
Financial Statements and Notes.
(3) Exhibits.
Exhibit Index
Exhibit Description
Form
File No.
Exhibit
Filing Date
Incorporated by Reference
Filed
Herewith
Exhibit
Number
3.1
3.2
10.1
Amended and Restated Certificate of
Incorporation of Etsy, Inc.
Amended and Restated Bylaws of Etsy, Inc.
Form of Indemnification Agreement between
Etsy, Inc. and each of its directors and executive
officers
10.2.1*
2006 Stock Plan, as amended, and forms of
agreements thereunder
10.3*
2015 Equity Incentive Plan
10.3.1*
Forms of agreements under 2015 Equity
Incentive Plan
8-K
8-K
001-36911
001-36911
3.1
3.2
4/21/2015
4/21/2015
S-1/A
333-202497
10.1
3/31/2015
S-1
S-1/A
333-202497
10.2.1
3/4/2015
333-202497
10.3
4/14/2015
10.4*
2015 Employee Stock Purchase Plan
S-1/A
333-202497
10.4
3/31/2015
Agreement of Lease, dated May 12, 2014,
among Etsy, Inc., 117 Adams Owner LLC and
55 Prospect Owner LLC
Employment offer letter between Etsy, Inc. and
Linda Kozlowski dated April 5, 2016
10.5
10.6*
S-1
333-202497
10.6
3/4/2015
10-K
001-36911
10.15
2/28/2017
10.6.1*
Letter Agreement between Etsy, Inc. and Linda
Kozlowski effective as of September 11, 2018
10-Q
001-36911
10.1
11/7/2018
10.7*
Letter Agreement between Etsy, Inc. and Josh
Silverman, dated May 2, 2017
10.8.1*
10.8.2*
10.9*
10.10*
Letter Agreement between Etsy, Inc. and Rachel
Glaser, dated April 2, 2017
Amendment to Letter Agreement between Etsy,
Inc. and Rachel Glaser, dated May 4, 2017
Employment offer letter between Etsy, Inc. and
Michael Fisher, dated July 27, 2017
Employment offer letter between Etsy, Inc. and
Jill Simeone, dated January 6, 2017
10.11* Executive Severance Plan
10-Q
001-36911
10.1
8/7/2017
8-K
001-36911
10.1
4/3/2017
10-Q
001-36911
10.2.2
8/7/2017
10-K
001-36911
10.11
3/1/2018
10-K
001-36911
10.12
3/1/2018
10.12.1* Management Cash Incentive Plan
S-1
333-202497
10.14
3/4/2015
10.12.2*
Amendment No. 1 to the Etsy, Inc. Management
Cash Incentive Plan
10-Q
001-36911
10.1
8/4/2016
136
X
X
Amended and Restated Compensation Program
for Non-Employee Directors, effective January
1, 2018
10.13
21.1
List of Subsidiaries of Etsy, Inc.
23.1
24.1
31.1
31.2
32.1†
32.2†
Consent of PricewaterhouseCoopers LLP,
Independent Registered Public Accounting Firm
Power of Attorney (contained in the signature
page to this Annual Report on Form 10-K)
Certification of Principal Executive Officer
Required Under Rule 13a-14(a) and 15d-14(a)
of the Securities Exchange Act of 1934, as
amended
Certification of Principal Financial Officer
Required Under Rule 13a-14(a) and 15d-14(a)
of the Securities Exchange Act of 1934, as
amended
Certification of Chief Executive Officer
Required Under Rule 13a-14(b) of the Securities
Exchange Act of 1934, as amended, and
18 U.S.C. §1350
Certification of Chief Financial Officer
Required Under Rule 13a-14(b) of the Securities
Exchange Act of 1934, as amended, and
18 U.S.C. §1350
101.INS XBRL Instance Document
101.SCH XBRL Taxonomy Schema Linkbase Document
101.CAL
XBRL Taxonomy Calculation Linkbase
Document
101.DEF
XBRL Taxonomy Definition Linkbase
Document
101.LAB XBRL Taxonomy Labels Linkbase Document
101.PRE
XBRL Taxonomy Presentation Linkbase
Document’
10-K
001-36911
10.19.3
3/1/2018
X
X
X
X
X
X
X
X
X
X
X
X
X
*
†
Indicates a management contract or compensatory plan.
These certifications are not deemed to be filed with the SEC and are not to be incorporated by reference into any filing of
Etsy, Inc. under the Securities Act of 1933, as amended, or the Securities Exchange Act of 1934, as amended.
Item 16. Form 10-K Summary
None.
137
Pursuant to the requirements of Section 13 or 15(d) of the Securities Exchange Act of 1934, the registrant has duly caused this
report to be signed on its behalf by the undersigned, thereunto duly authorized.
Signatures
ETSY, INC.
Date: February 28, 2019
/s/ Rachel Glaser
Rachel Glaser
Chief Financial Officer
(Principal Financial and Accounting Officer)
Power of Attorney
KNOW ALL PERSONS BY THESE PRESENTS, that each person whose signature appears below hereby constitutes and
appoints Josh Silverman and Rachel Glaser, and each of them, as his or her true and lawful attorney-in-fact and agent with full
power of substitution, for him or her in any and all capacities, to sign any and all amendments to this Annual Report on Form
10-K and to file the same, with all exhibits thereto and other documents in connection therewith, with the Securities and
Exchange Commission, granting unto said attorney-in-fact and agent full power and authority to do and perform each and every
act and thing requisite and necessary to be done in connection therewith, as fully for all intents and purposes as he or she might
or could do in person, hereby ratifying and confirming all that said attorney-in-fact and agent, or his or her substitute, may
lawfully do or cause to be done by virtue hereof.
Pursuant to the requirements of the Securities Exchange Act of 1934, this report has been signed below by the following
persons on behalf of the registrant and in the capacities and on the dates indicated.
Signature
Title
Date
/s/ Josh Silverman
Josh Silverman
/s/ Rachel Glaser
Rachel Glaser
/s/ Fred Wilson
Fred Wilson
/s/ Gary Briggs
Gary Briggs
/s/ M. Michele Burns
M. Michele Burns
/s/ Edith Cooper
Edith Cooper
/s/ Jonathan D. Klein
Jonathan D. Klein
/s/ Melissa Reiff
Melissa Reiff
/s/ Margaret M. Smyth
Margaret M. Smyth
President, Chief Executive Officer, and Director
(Principal Executive Officer)
February 28, 2019
Chief Financial Officer (Principal Financial and
Accounting Officer)
February 28, 2019
Chair
Director
Director
Director
Director
Director
Director
February 28, 2019
February 28, 2019
February 28, 2019
February 28, 2019
February 28, 2019
February 28, 2019
February 28, 2019
138
[THIS PAGE INTENTIONALLY LEFT BLANK]
[THIS PAGE INTENTIONALLY LEFT BLANK]
2018 Integragrgggg ted Report
Exexexexeeecutcutcutcucutcc tcc iveivivivi Officficficficficficffiicfff ers
Jososososoo h Silvlvvilvverermermermermermermr ananaaaa
ChiChiChiChiChiChiChiChChiCCChiCh ef ef efef ef eefee Exexeeecutcutcutcutcuu iveiveeee Offfffffffficeicic r
RacRacRaccacRacc elhelhelhelheleleeeleeele GlGlaseaseeerrrrrr
ChiChChChiChCCh ef ef efffffffff FininFinFinFinFinFinFinFinFiFinFinFiF ancancancanancancancancanancannnana
iaial OffOffOffOffffOffOffffOffffffffiiceiceiceiceiceiceiceiceeei
rrrrrrrrrrr
MikMikMikMikMikMikMiMikMikMiMikMikMMMMMM e Fe FFFFFFFe FFFFFFFFishishisisiss erer
ChChiChChChCChC ef ef TecTecTecTecTecececececececechnohnohnohnohnohnohnohnohnohnohnohnohnhnohnhnohnhhnohnoonn loglogloglogy Oy Oy Oy Oy Oy Oy OOOOfficfficfficfficfficfficfficfficfficfficererererererereerr
Raina Mososososskowkowkowkowk wowitz
SenSenSeSenSenSenSenSeSenSSeSe ior Vice cecece cecee PrePrePPresidsidsidsidsidididdidididdenenenteneneee , Peopeoeoeooeeoeoee
StrStrStrStrStrStrStrStrSttStrt ateaaateaaaaa gy,gy,gy,y,y anannanannnnnnd Sd Sd Sd Sd Sd Sd Sd Sdd Sd Sd Serverververvrvrvrvervvr iciceiceiceicecc ssssss
le,
KruKruKruKrurKruKruKruKruKruKK ti titi ti ti ti itiiiii ti PatPatPatPaPaPatPatPatPatPaPaPaPatPatPatPaPaaaa eleleeeleeleel GoyGoyGoyGGoGGGGGG alalaaaa
SenSenSenSenSennSenSennSee ioriororiorioriorioroioiio ViViViViViViViViiVViice ce ce ce cece cee ce PrePrereresidsidsidsidddsiddentententntententenentnnnn , P, P, P, PPP, P, P, P, P, PPProdrodrodrodrodrodrodroddododrod tuctuctuctuctucuctuctuctuccu
imeeoneoneoneoneneeoneoneoneoneeo
JilJilJilJilJilJilJilJililJ lll Sl lll
GenGenGenGenGenGenGenGeneneeGenGe eraerar l Cl CCl CCCCCCCounounounounouu sel ananannnand d dd d ddddddd
SeSecSecSecSSeSecSeSecSSSS retetetretttetetettttttararararyaryaaarararararaaaa
BoaBoard of o Directectorso
Fred Wilson, Chair
Managing Partner,
Union Square Ventures
Jonaththan an D.D. KleKleinnin
Co-Foundender ar andnd DepDepDeputyutyuty
Chairmr an, Getty ImImageages,s, IncInc.
MelMelississa Ra Reiff
ChiChief ef ExeExecutcutiveive OffO icer, The
ConContaitainerner StStoreore GrGroupoup, Inc.
Josh SSilvilvermermanan
Chief Executtiveiiiii OffOfficeicer,r
Etsy, Inc.
MarMargarga et M. Smyth
U.SU.SS. C. Chiehief Ff Finaancial Officer,
NatNatNa ionionalal GriGridd
GarGary Sy S. B. Brigriggsgs
Formere ViVice President and
ChiChief e MarMa keting OffO icer,
Facebook, Inc.
M. Michele BBurnurnss
Former ChChiefief ExExecucutivtivt e
Offiicercer, R, Retietiremrement PoPoliclicy
CeCenter, MMarsrsh &h & McM Lennann
Companies, I, Inc.ncnc
Edith W. CooC per
Former Executive VVice
President, Global Head,
Human Capital
Management, Goldman
Sachs Group, Inc.
Investor Relations
Information about EtsEtssy,y, prepreressss
relrelease es, blog posts,s, anannd dd
othotherer investe or infformormmatiata on on is s
avavailal bleble onon ouur wwebsebsbsitee atat: :
invinvestestorsors.et.e sy.sy comcom
yy
StStockholdder er inqinquiruirriesiesies
canan be sesent nt viavii ememailailll too::
IR@R@@etsetsy.cy.comm
@@@ y
InIndIndepepeendendentnt RegRegRegististi ereeredd
PubPubPubliclic Acccoucoucountintitinng ng FirFirmm
PriPriPr cewcewcewateatea rhouseuseeCooCooperpers Ls LLP LP
3003000 Madisdissononon AveAveAv nuee
Neww YoYoYork,rkrk NYYNY 101010017017
CorCorporporo ateate HeHeadqadquaruarterterss
EtsEtst y, y, IncInc..
117177 AdAdA amsamams StStStreereet t
BBroBroB oklok yn,yn,, NYNYY 111120120201
EtEtsEtsEtsy.cy.cy omommyyy
TraTransfnsfsfer er e AgeAgent ntn
QueQueQuestistit onsons frfrf omomom stotockhc oldldersers
of ofof recerecordord regara dind g sg stoctock k
cercerce tifificaicatestes, changeses ofof adaddred ss
andand ototherr isssuesues ss shouhouldl be
dirdirectecteded to:to:
ComComputputersersharhare Trust
ComCompanpany, y, N.AN.
.
AttAttn:n ShaShareholder Services
P.OP O. Box ox 505505000
Louo isville, KY 40233-5000
1(8( 77) 373-6374
Hearing Impaired:
TDD 1(800) 9))) 52-9245
p
wwwww.compup tershare.com
Etsy’syy coommommon stock ik is ls ististtteeeeeeded eeed eee
on n Nasdaq ununderer ththe te icki er er
symbolll “E“ TSYTSY””
We love our planet. This report was printed on paper
that contains recycled content which is FSC® certified
and made with post-consumer waste.
This Annual Report includes forward-looking statements within the
meaning of the federal securities laws. Forward-looking statements
include statements related to our outlook, business strategy, market
size, planned marketing activities, impact strategy, and product
development initiatives. Forward-looking statements include all
statements that are not historical facts. Forward-looking statements
involve substantial risks and uncertainties that may cause actual
results to differ materially from those that we expect, including those
risks and uncertainties identified in the section titled “Risk Factors”
in the Form 10-K included in this Annual Report. Forward-looking
statements represent our beliefs and assumptions only as of the date
of this Annual Report. We disclaim any obligation to update these
forward-looking statements.
2018 Integrated Report